Pleiotropic Signaling in the Endocannabinoid
System: The role of the G protein γ3 subunit
A
THESIS
SUBMITTED TO THE SCHOOL OF GRADUATE STUDIES
of
BLOOMSBURG UNIVERSITY OF PENNSYLVANIA
IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF
MASTER OF SCIENCE
PROGRAM IN MOLECULAR BIOLOGY DEPARTMENT OF BIOLOGY AND
ALLIED HEALTH SCIENCE
BY
ALEX PASCULLE
BLOOMSBURG, PENNSYLVANIA
2022

1

Abstract
The Cannabinoid 1 (Cb1) receptor is increasingly recognized as being involved in
numerous pathological and physiological processes. Classical Cb1 receptor signaling
occurs at the pre-synaptic terminal, where it couples to Gαi/o proteins to inhibit adenylyl
cyclase and mediate retrograde inhibition. It is now well established that Cb1 signaling is
pleiotropic and occurs in many different cell types through the actions of different Gprotein alpha (α), beta (β) and gamma (γ) subunits. While Gβγ has been identified as
having specific roles in this signal transduction process, the unique roles that individual Gγ
subunits perform remains elusive. To explore these roles, we transiently overexpressed
Cb1 and Gγ3 (Gng3) in a CHO-K1 cell line and measured cAMP accumulation following
receptor activation. We hypothesized that overexpression of Gng3 would result in
preferential coupling of Gγ3 into the Gαβγ heterotrimer and result in an altered response
when compared to cells only expressing Cb1. However, lack of statistical significance and
the high variation between trials lead us to reject this hypothesis. Similarly, we used this
overexpression model to measure intracellular calcium levels in cells expressing Cb1 or
Cb1+gng3. We found that stimulation of Cb1 with Anandamide had no effect on
intracellular calcium in either group. Next, we used a CRISPR-Cas9 gene targeting
approach against Gg3 in developing Danio rerio (zebrafish) embryos. Our approach at
targeting the gng3 allele was successful, with target efficiency of up to 95% in the F0
progeny. Finally, we utilized a series of behavioral assays to measure Visual and Acoustic
startle responses in wild type Zebrafish. Herein, we report on these experiments and how
additional troubleshooting of these assays are needed before any claims can be made on
the mutant phenotype.

2

Acknowledgements
Words cannot express my gratitude to my Major Professor, Dr. Schwindinger, for his
guidance and patience throughout this endeavor. This work would also not of been
possible without the help of my committee members—Dr. Klingerman and Dr. Coleman,
and the rest of the faculty in the Bloomsburg University Department of Allied Health
Sciences.
Furthermore, I would like to thank my friends and colleagues in the M.S. program for
their help with editing, researching, discussing and moral support. Thanks should also go
to Dr. Hranitz and Thomas O’Rourke for their help with the statistics, and to Ayushi
Umrigar and Eric Moeller for helping with my experiments.
Lastly, I would like to extend a special thanks to my family, especially my mom and
sisters for always encouraging me to be my best. This project has given me a new
appreciation for science and all things G-proteins.

4

Table of Contents
ABSTRACT………………………………………………………………………………2
THESIS APPROVAL SIGNATURE PAGE………………………………………… 3
ACKNOWLEDGMENTS…………………………………………………………….…4
LIST OF TABLES………………………………………………………………………6
LIST OF FIGURES……………………………………………………………………7
LIST OF APPENDICES………………………………………………………………8
INTRODUCTION………………………………….……………………………………9
1. ENDOCANNABINOID SYSTEM………………………………………………….….……9
1.1 COMPONENTS OF THE ENDOCANNABINOID SYSTEM……………………9
1.2 THE BIOLOGICAL ROLE OF THE ENDOCANNABINOID SYSTEM…...…10
1.2.1 ECB IN THE NERVOUS SYSTEM……………………………….…11
1.2.2 THE ECB IN THE CARDIOVASCULAR SYSTEM…………….…12
1.3 THE ENDOCANNABINOID SYSTEM IN ZEBRAFISH……………….………13
2. G PROTEIN COULES RECEPTORS AND HETEROTRIMERIC G-PROTEINS……17
2.1 SYNTHESIS AND MODIFICATIONS OF G PROTEINS…………...…………18
2.1.1 Ga………………………………………………………………………18
2.1.2 Gb AND Gγ……………………………………………………………18
2.2 SIGNALING AND REGULATION………………………………………………20
3. CANNABINOID RECEPTOR 1…………………………………………………...………21
3.1 BIOLOGY AND DISTRIBUTION OF CB1……………………………...………21
3.2 SIGNALING AND G-PROTEIN COUPLING……………………………...……22
4. THE Gγ SUBUNIT………………………………………………………………….………24
4.1 BIOLOGY OF Gγ…………………………………………………………….……24
4.2 SPECIFICITY OF Gγ………………………………………………………..….…24
4.3 THE Gg3 SUBUNIT ………………………………………………………………26
METHODS …………………………………………………………………………29
RESULTS………………………………………...…………………………………44

DISCUSSION………………………………………………...…………………………50
REFERENCES………………………………………………….………………………84

5

LIST OF TABLES
TABLE 1: NON-EXHAUSTIVE TABLE OF G-PROTEIN EFFECTOR PATHWAYS…98
TABLE 2: NON-EXHAUSTIVE LIST OF CB1 PLEIOTROPIC SIGNALING……,,,…100
TABLE 3: PCR PRIMERS……….………..………..………..………..………..………104
TABLE 4: AVERAGE DISTANCES TRAVELLED DURING STARTLE………..……112
TABLE 5: SURVIVAL RATES FOR INJECTION TRIAL 0………..………..………..117
TABLE 6: SURVIVAL RATES FOR INJECTION TRIAL 1………..………..……..….118
TABLE 7: SURVIVAL RATES FOR INJECTION TRIAL 2………..……..………..…119

6

LIST OF FIGURES
FIGURE 1: THE ENDOCANNABINOID SYSTEM…………………...……………97
FIGURE 2: ACTIVATION OF A GPCR…………………………………………..…99
FIGURE 3: MAP OF PCDNA3.1 RESTRICTION SITES AND INSERTS………101
FIGURE 4: MAP OF PCDNA3.0 RESTRICTION SITES AND INSERTS………102
FIGURE 5: SCHEMATIC OF CRISPR/CAS9 TARGETING GNG3………….…103
FIGURE 6: EMBRYOS LINED UP BEFORE MICROINJECTION……….……105
FIGURE 7: PCR PRODUCTS OF CDNA ISOLATES…………..………..….……106
FIGURE 8: RESTRICTION ENZYME DIGEST OF PLASMIDS…………..……107
FIGURE 9: CAMP-GLO STANDARD CURVE………..………..………..……..…108
FIGURE 10: FURA-2AM CALCIUM TRACINGS………..………..………...……109
FIGURE 11: AVERAGE DISTANCE TRAVELED IN VMR ASSAY………..…..110
FIGURE 12: DISTANCE TRAVELLED IN AUDITORY STARTLE ASSAY…..111
FIGURE 13: HISTOGRAM OF STARTLE LATENCY………..………..………..113
FIGURE 14: PCR PRODUCTS OF CRISPANTS………..………..………..……...114
FIGURE 15: INDEL PLOT FROM CRISPANTS………..……..………..….……..115
FIGURE 16: CHROMOGRAM AND PHOTO OF CRISPANT………..…...…….116

7

LIST OF APPENDICIES
APPENDIX 1: IACUC FORMS……..………..………..………..………..………..120
APPENDIX 2: SUPPLEMENTAL FIGURES………..………..………..………..133

8

1. INTRODUCTION

1.1. Components of the Endocannabinoid system
The Endogenous Cannabinoid System is composed of the Cannabinoid receptors
(Cb1 and Cb2), their endogenous ligands (endocannabinoids), and the enzymes
responsible for the synthesis and degradation of the endocannabinoids. Narachidonoylethanolamide (AEA) and 2-arachidonylglycerol (2-AG) are the two
principal ligands. Unlike classical neurotransmitters that are stored in secretory vesicles,
the lipophilic nature of the two main endocannabinoids allows for simple diffusion across
the lipid bilayer. Alternatively, endocannabinoids may be transported into or out of the
cell through the Endocannabinoid Membrane Transporter (Nicolussi et al., 2015, Fowler
2013) (Figure 1).
N-Arachidonoyl-ethanolamine, more commonly referred to as ‘Anandamide’,
contains an ethanolamine conjugated to an eicosanoid derivative. Biosynthesis of
Anandamide (AEA) occurs in a Ca2+ dependent manner by the integral membrane protein
N-Acyl phosphatidylethanolamine Phospholipase D (NAPE-PLD). AEA is broken down
by an integral membrane protein, Fatty Acid Amid Hydrolase (FAAH) (Cascio and
Marini 2015, Wiley et al., 2018). Like AEA, 2-AG is also synthesized in a Ca2+
dependent manner by a membrane protein that sits within the inner membrane of the lipid
bilayer. In the case of 2-AG, Diacyl Glycerol Lipase (DAGL) catalyzes the cleavage of 2AG from a diacyl glycerol molecule in the lipid bilayer (hill and tasker 2012). Despite
sharing similar biochemical properties, key differences in their biosynthesis, degradation,

9

and receptor affinity allow the two ligands to perform selective or pleiotropic functions.
AEA has been proposed to represent a tonic signal, continuously regulating
neurotransmitter release, while 2-AG is responsible for a phasic signal that is required for
synaptic plasticity (Kilaru and Chapman, 2020).
Advancements made in fields such as biochemistry (Ropke et al., 2021), lipid
signaling (Zamberletti et al., 2017), and pharmacology (Kaczocha and Dahmane, 2021)
have allowed for an expanded definition of what is considered part of the
endocannabinoid system. For instance, the identification of two other putative receptors
with partial affinity to endocannabinoids—the orphan GPCR 55 (GPR55) (Ryberg et al.,
2007) and the transient vanilloid type-1 (Trpv-1) channel (Muller et al., 2018; 2021)
represent another ‘layer’ of signaling pleiotropy and further highlight ambiguities in what
we currently know about this system. While the Endocannabinoid system encompasses
numerous components, the scope of this project is limited to the Cb1 receptor and its
activation by Anandamide.
1.2. The Biological role of the Endocannabinoid system
Extracts from the plant Cannabis sativa has been used for centuries to treat conditions
ranging from chronic pain to epilepsy. First credited with introducing cannabinoids into
Western medicine was Irish physician William O’Shaughnessy (W. B. O’Shaughnessy,
1843). However, it was not until the cloning of the Cannabinoid 1 receptor (Cb1) by
researchers at the National Institutes of Health (NIH) (Matsuda et al., 1990) that the
mechanisms of how these effects are attained were first explored. Since then, a large
body of experimental literature has been published speculating the biological role of the
cannabinoid system (see review Skaper and Marzo et al., 2012). Here I present just a few

10

instances showing the ubiquity of the endocannabinoid system and its role in many
biological systems.
1.2.1. The Ecb in the Nervous System

The Cb1 receptor is the most abundantly expressed receptor in the central nervous
system (CNS) (Hu, S. et al., 2015). Despite its widespread distribution, teasing out the
physiological role for the Cb1 receptor in humans has been a daunting task. One
apparent function of the Cb1 receptor is to attenuate analgesia. Pernia-Andrade et al.,
used paired pulse and extracellular electrophysiological recording experiments to show
that the synthetic Cb1 receptor agonist WIN activates receptors on inhibitory dorsal horn
interneurons and subsequently reduces the release of GABA and Glycine onto
nociceptive C fibers (Pernia-andrade et al., 2010). Preclinical models using Cb1 receptor
agonists in model organisms have also been able to exploit the anti-nociceptive properties
of Cb1 through peripheral and central injections of Cb1 receptor agonists. Moreover,
these effects were counteracted using selective Cb1 antagonists (Racz et al., 2015; J.
Lotsch, et al., 2017).
Activation of the cannabinoid receptors has been proposed to alleviate the
symptoms and progression of many different neurodegenerative diseases. Early support
for a role of the endocannabinoid system in neurodegenerative pathologies came about
when alterations of endocannabinoid signaling components were observed in the
cerebrospinal fluid (Di Filippo et al., 2008), blood (Jean-Gilles et al., 2009) and neural
tissue (Centonze et al., 2007), in both human and animal models of disease. These
alterations in the expression pattern and distribution of Cb1 in different models of disease

11

suggest a role for the endocannabinoid system in neuropathologies (See review Cristino
et al., 2020).
1.2.2. The ECB in the Cardiovascular System
At the molecular level, Cb1 is expressed by endothelial cells in the tunica intima,
vascular smooth muscle cells (VSMC) in the tunica media, and cardiomyocytes in the
myocardium. While the biological function of Cb1 in these tissues remain elusive, Cb1 is
significantly upregulated in response to cardiac ischemia and tissue damage. When
activated under these conditions, the majority of Cb1 signaling occurs from activation of
the sympathetic, and inhibition of the parasympathetic nervous system (Sara-lena Puhl
2020).
Like many other receptors, Cb1 also activates non-classical G protein pathways. For
instance, In vitro application of Cb1 agonists and antagonists to rat (Domenicalli et al.,
2005) and human (Stanley et al., 2016) mesenteric artery cause vasorelaxation through
the activation of Endothelium derived Nitric oxide synthase (ENOS) from endothelial
cells. In this scenario, AEA activation of Cb1 on endothelial cells causes the G-protein
dependent activation of the MAPK cascade (J liu, 2000)—ultimately leading to activation
of ENOS and the release of Nitric Oxide (NO) which will cause local vasodilatory effects
on the VSMC surrounding the vessel (Stanley, 2016). Similarly in cardiomyocytes, Cb1
receptor activation causes an overall negative inotropic effect and thereby decreasing
contractility (S. Batkai, et al.,2004).
Cb1 activation on peripheral nerve terminals of post ganglionic sympathetic neurons
leads to a decrease in the amount of Norepinephrine (NE) released by Sympathetic
neurons and thereby decreases the “sympathetic tone” (S. Batkai, et al.,2004). On the

12

contrary, in the CNS, activation of Cb1 causes an increase in sympathetic tone. When
AEA is administered systemically, an overall increase in sympathetic tone occurs. The
opposing effects of AEA acting systemically as a positive inotrope and locally as a
negative inotrope can be partially reconciled when considering a protective role for the
Endocannabinoid system in cardiovascular pathology. While central injection of AEA
results in an overall increase in sympathetic tone (S. Batkai, et al.,2004), local release of
AEA causes an overall decrease in sympathetic tone serving as a protective mechanism
against ischemia and reperfusion injuries (Maeda et al., 2009). While the function of the
endocannabinoid system in the cardiovascular system is outside the scope of this thesis, it
demonstrates the ubiquity of Cb1 signaling in multiple systems and highlights how a
strong understanding of the molecular events governing these responses can create
endless possibilities in treating a range of pathologies.
1.3. The Endocannabinoid system in zebrafish
Zebrafish have been a robust tool for researchers investigating various aspects of
biology and pharmacology in vertebrates. This is in part because of the high genetic
homology (~70%) between zebrafish and humans (Howe et al., 2013) and the presence of
approximately 84% of orthologous genes known to cause disease in humans (Grunwalk
et al., 2002). Sequencing of the Cb1 receptor in zebrafish revealed a 69% nucleotide and
73.6% amino acid sequence homology when compared to Cb1 in humans (Lam CS., et
al.,2006). Zebrafish also contain orthologs to the human genes encoding the various other
components of the endocannabinoid system including the enzymes NAPE-PLD, FAAH
and DAGL (Migliarini B and Carnevali o, 2006). Another advantage in using zebrafish as
biological models is the presence of a clear chorion and easy methods of genetic

13

manipulation that make visualizing and characterizing the developing larvae relatively
easy and amenable to high throughput assaying when compared to other model organisms
(Choi et al., 2021).
Following a similar expression profile as their mammalian counterparts, zebrafish
begin expressing Cb1 in the preoptic center of the hypothalamus at the 3-somite stage of
development (24 hpf) (CS lam 2005). The expression pattern of Cb1 in the developing
zebrafish dorsal telencephalon coincides with the development of inhibitory GABAergic
neurons. Interestingly, Cb1 was preferentially expressed in a subset of neurons in the
locus coeruleus that give rise to the Vth cranial nerve (Trigeminal nerve). One
interpretation of this finding could be that Cb1 regulates the release of GABA, which
modulates the inhibitory activity in the ventral striatum (Watson et al.,2006) and
subsequent release of dopamine onto dopaminergic neurons in the substantia nigra.
Moreover, intense signals in the diencephalic posterior tuberculum (homologous to the
mammalian mid-brain dopamine system) and the medial zone of the dorsal telencephalon
suggests that the Cb1 may be involved in reward-related behaviors, hippocampal and
memory formation, and other cognitive processes (CS lam 2005). This interpretation is
only speculative and may be misleading considering the researchers were only concerned
with the temporal and spatial patterns of expression of Cb1. Nevertheless, it provides
empirical support for the involvement of Cb1 in the development and maintenance of
various structures and processes in the CNS.
Elucidating the intricate and ubiquitous expression patterns of Cb1 throughout
development has proven to be a daunting task. Pharmacological perturbation and gene
targeting strategies have been of tremendous value for researchers interested in ascribing

14

biological function to the endocannabinoid system. An excellent example of this
occurred in 2008 when Watson et al., demonstrated that pharmacological inhibition of the
Cb1 receptor in developing zebrafish led do defects in axon pathfinding and fasciculation
in the striatum (Watson et al.,2008). A similar yet more exaggerated phenotype was
observed in embryos injected with antisense morpholinos (MO) to the Cb1 receptor.
100% of the developing morphants exhibited significant disorganization and loss of
fasciculation in tracts of the medial longitudinal fasciculi (MLF) (Watson et al.,2008).
This led researchers to conclude that axonal elongation, pathfinding, and fasciculation is
mediated, at least in part, by the Cb1 receptor.
There have been relatively few zebrafish studies aimed at functionally characterizing
the Cb1 receptor in terms of its biological role in the endocannabinoid system. While this
may be attributed to the growing interest in studying exogenously derived cannabinoids
like CBD and THC to treat diseases, it highlights a large gap in our knowledge regarding
the basic phenotypes involved in endocannabinoid signaling of lower vertebrates.
Nevertheless, activation of Cb1 in zebrafish has been shown to produce conflicting
phenotypes. For instance, Connors et al., (2014) reported an apparent anxiolytic-like
response in adult zebrafish treated with the synthetic Cb1 receptor agonist WIN55212-2.
This comes in stark contrast to other studies where Cb1 activation caused anxiogenic-like
responses (Stewart & Kalueff 2014, Ruhl et al.,2016). These later studies agree with
preliminary data generated from the Klingerman lab which suggests activation of the Cb1
receptor in adult zebrafish increases locomotion and anxiety related behaviors (in press,
Schaffer and Moeller 2020) Collectively, these results may suggest the emergence of
distinct, yet conserved functions mediated by the Cb1 receptor.

15

Zebrafish possess a large repertoire of innate behavioral responses that are “hardwired” into their brain. The sensory-motor circuits responsible for eliciting these
responses must provide the organism with the ability to detect and avoid predators and
guide them into a safe and nourishing environment (Neuhauss, 2003;Burgess and Granto,
2007;Vaz et al.,2019). Similar to the pupillary response that occurs in mammals exposed
to a photic stimulus, zebrafish have also been shown to display varying optomotor
responses. Previous studies have described a distinct series of behaviors that occur in
response to abrupt changes in illumination and are thought to facilitate an escape from
overhead predators (Easter and Nicola, 1997; Orger and Baier, 2005; Lutchenburg et al.,
2019). These responses are collectively referred to as the Visual Motor Response (VMR)
and occurs when zebrafish are exposed to sudden dark or flashes of light. The VMR is
often initiated several hundred milliseconds (ms) after presentation of light flashes and
results in higher levels of locomotor activity in zebrafish (when compared to basal levels)
(Burgess and Granto, 2007). Several studies have used the VMR in zebrafish as a
behavioral paradigm to ascribe function to various aspects of zebrafish biology. Recent
discoveries have identified the trigeminal nerve as having crucial functions in the VMR
of zebrafish (koshashi 2012 and koide 2018). Here, we attempted to use the VMR assay
to characterize the phenotypes of zebrafish mutants and to further understand the role of
the endocannabinoid system in primitive responses. As discussed later, the mutant
zebrafish generated in this study did not develop to 7dpf when the assay was planned to
occur and thus prevented us from generating VMR data on mutants.
Like the VMR displayed early in the development of zebrafish larvae, the auditory
startle response is an innate response that develops around 5dpf (Zeddies and Fay, 2005).

16

This response is initiated by a high-intensity acoustic stimulus that activates a large group
of reticulospinal neurons called Mauthner cells (M-cells). After activated, M-cells
synchronously synapse to contralateral spinal motor neurons causing a characteristic “Cbend”. The C-bend acts to propel fish away from the stimulus or perceived threat (Eaton
et al., 2001). Considering that the Cb1 receptor is often involved in the inhibition of
retrograde neurons in the CNS, we used this acoustic startle paradigm to determine
weather Cb1 was involved in enhancing or limiting this response in juvenile zebrafish.
2. G Protein Coupled Receptors and Heterotrimeric G-Proteins
Containing over 800 members encoded in the human genome, G-Protein Coupled
receptors (GPCRs) are the most abundant superfamily of membrane protein receptors in
mammals and a major target for pharmacological agents. GPCR’s transduce extracellular
signals like photons or neurotransmitters into an intracellular signal that is amplified
through a G-protein signaling cascade. GPCRs are classified into five families based on
sequence homology and functional similarity. The vast majority of these proteins belong
to family A or Rhodopsin-like receptors (Syrovatkina et al., 2016). All GPCR’s share
similar structural features and are characterized by an extracellular N-terminus, and
intracellular C-terminus and seven trans-membrane spanning α-helices. When the
receptor is in its inactive state, the intracellular domain is associated with the
heterotrimeric G protein composed of alpha (α), beta (β) and gamma (γ) subunits. While
the α subunit is GDP-bound, the β and γ subunits are tightly associated with each other.
The receptor is then activated by agonist binding which catalyzes the exchange of GTP
for GDP followed by the disassociation of the Gα-GTP bound subunit from the βγ dimer. Both Gα and Gβγ will activate signaling cascades. The signaling is terminated

17

following the hydrolysis of GTP to GDP catalyzed by the biophysical GTPase properties
of the Gα subunit (Weis, W. et al.,2018, NCBI; Figure 2).
2.1. Synthesis and modifications of G proteins
2.1.1. Gα
Humans contain 16 genes that code for Ga subunits, which are classified into four
families based on sequence and functional homology. These families— Gαs Gαi/o, Gαq
and Gα12/13 = are broadly responsible for stimulating Adenylyl Cyclase (AC), Inhibiting
AC, activating PLC and activating RhoGEFs, respectively (Hollmann et al., 2005).
Considering that these responses are not solely mediated by the identity of the Gα
subunit, these responses have also been used to characterize the canonical response of the
GPCR.
There are two different types of modifications that Gα can undergo—
myristoylation and palmitoylation. These lipid modifications allow the Gα protein to
remain associated with the inner leaflet of the plasma membrane (Mumby et al., 1990). In
addition to the lipid modification incurred by Gα, yet another important factor in
membrane anchorage is found to be encoded right in the amino acid (AA) sequence— the
polybasic motif. In many of the Gα subunits, a stretch of around 10 positively charged
AA’s are found grouped together in its Amino terminal and is believed to facilitate
interactions with the negative membrane surfaces (Kosloff 2002).
2.1.2. Gβ and Gγ

There are at least five beta subunits that are encoded for by different genes giving
rise to the Gβ 1-5 subunits. Gβ 1-4 share greater than 80% amino acid homology
compared to only 50% with Gβ5 (Smrcka, 2008). Several Gβ subunits also contain

18

polybasic motifs located on the amino terminus. Polybasic motifs in Gβ are a conserved
sequence of positively charged amino acids that are also believed to facilitate membrane
anchoring through its interactions with the acidic phospholipid membrane (Murray et al.,
2001).
Nascent Gβ and Gγ subunits dimerize in the cytoplasm before being recruited to
the ER, where these modifications occur post translationally (Murray et al., 2001).
Several putative molecular chaperones like Chaperonin Containing Tailless-complex
polypeptide 1 (CCT) (Lukov et al.,2006) and the ER resident Dopamine Receptor
interacting Protein 78 (DRiP) 78 (Dupre,2007) have been identified that coordinate the
processing and shuttling of G-proteins within the cell. These proteins are thought to
contribute to the assembly of a specific Gβxγx dimer (Marrari et al., 2007). Assembly of a
preferential Gαβγ heterotrimer is one of the many factors thought to contribute to
signaling pleiotropy.
The lipid modifications that occur to the γ subunit are done by specific
transferases known as farnesyl and geranylgeranyl transferases (Marrari et al., 2007,
Hynes et al., 2004). Prenylation is a unique modification that occurs in CaaX box
proteins. The CaaX box is a combination of the last 4 amino acids found at the C terminal
of the protein. The C stands for cysteine, meaning that a cysteine residue must be the
fourth-to-last amino acid (Hynes et al., 2004). This is the amino acid where the prenyl
moiety, either farnesyl or gerynylgerynyl, will be added. The two “a” represent the
presence of some aliphatic amino acid and the amino acid in position X is what
determines which of the two prenyl groups (Farnesyl and Geranylgeranyl) will be added
(Hynes et al., 2004).

19

For the addition of a farnesyl group, the amino acid in the X position needs to be
either an alanine, serine, or methionine. Gγ 1, 9 and 11 all have a serine residue in the C
position and are therefore farnesylated. For the addition of a geranylgeranyl group, the
amino acid in position X must be a leucine. The rest of the Gγ proteins all contain a
leucine in the X position and are thus geranylgeranylated. In contrast to the lipid moieties
added onto the Gα subunit, processing of Gγ requires post-prenylation modifications
before it can properly assemble. The first post-prenylation modification is the proteolytic
removal of the aaX Amino acids, so that the prenylated cysteine residue is the first
Amino acid at the C terminus. Following aaX proteolysis comes methylation of the Cterminal carboxyl group. Carboxymethylation is important because it contributes to the
hydrophobicity of the C terminus (Evanko et al., 2000) thereby facilitating anchorage to
the membrane.
2.2. Signaling pathways and Regulation
By convention, GPCRs have been characterized by the identity of the Gα subunit
by which it preferentially couples to. This is because of data that has accumulated over
the years identifying well defined or Canonical signaling pathways mediated by Gα
(Table 1). The family Gαs was named as it is responsible stimulating Adenylyl cyclase
(AC), which converts ATP to cAMP leading to an increase in intracellular cAMP. In
contrast, Gαi/o was named after its inhibitory effect on AC leading to an increase in
intracellular cAMP. The family Gαq is responsible for activating phospholipase C beta
(PLCbeta) which hydrolyzes Phosphatidylinositol 4, 5-biphosphase (PIP2) into
diacylglycerol (DAG) and inositol 1, 4, 5-triphosphate (IP3) causing the subsequent
opening of IP3 channels on the ER and release stored Ca2+ (Syrovatkina et al., 2016).

20

Throughout this thesis, we will refer to these responses generally as Gs Gi/o and Gq to
eliminate confusion when discussing the role of Gγ in G protein signaling.
In addition to signaling pathways mediated through Gα proteins, Gbg dimers also
initiate signaling through a wealth of well-defined effectors (Syrovatkina et al., 2016).
The existence of these non-canonical signaling pathways has made characterizing GPCR
response difficult and are often overlooked by researchers who are strictly defining
GPCR’s as signaling through their Gα subunit. Table 1 shows a non-exhaustive table of
well-defined effectors for Gα and Gβ/γ and their physiological relevance.
3. Cannabinoid Receptor 1
3.1. Biology and Distribution of the Cb1 receptor
Cb1 is encoded by the intronless CNR1 gene found on chromosome 6 locus q14-q15
andconsists of a 472 amino acid sequence sharing 97-99% sequence homology with rat
and mouse. Multiple Isoforms coming from the 5’-UTR have been identified. CNR1 also
contains three noncoding exons allowing for the alternative splicing variants Cb1A,
Cb1B, Cb1C, and Cb1D.
These isoforms are a result of intraexonal splicing events of CNR1 and contain a variable
5’untranslated regions (González-Mariscal, I. et al., 2016). The presence of these splice
isoforms is only one example of the different post transcriptional mechanisms responsible
for signaling pleiotropy.
A high concentration of Cb1 has been observed in the presynaptic terminals
of neurons found within the nervous system, where it functions as a retrograde signaling
mediator by inhibiting the influx of Ca2+ into the presynaptic cell—thus hindering the
release of neurotransmitters from that cell (Katona, I. et al.,1999 ,Hu, S. et al., 2015).

21

Ultimately, this leads to long- and short-term effects on synaptic plasticity where it often
modulates multiple neuronal circuits and functions as a homeostatic regulator of neuronal
excitability (wright et al., 2017). Cb1 is most abundantly expressed in the olfactory bulb,
hippocampus, basal ganglia and cerebellum. Moderate levels of Cb1 expression have
been reported in the cerebral cortex and dorsal horns of the spinal cord. In contrast, lower
expression has been reported in the ventral horn and thalamus (Veress, G. et al., 2013). In
the Peripheral Nervous System (PNS) Cb1 is primarily present in the sympathetic nerve
terminals, the trigeminal ganglion, Dorsal root ganglion, and in the dermic nerve roots
(Clapper, J. et al.,2010) where it is thought to regulate nociception from afferent
pathways.
3.2. Signaling Pathways and G-protein coupling
The Cb1 receptor is a member of the rhodopsin family of G-Protein coupled
receptors. It was initially proposed by Howlett and Fleming in 1984 that Cb1 exerts its
biological effects through the preferential coupling to Gαi/o proteins. Support for this
hypothesis came about when Howlett showed that cAMP production was inhibited upon
D9-THC treatment in Cb1 expressing neuroblastoma cells and blocked when treated with
pertussis toxin (PTX) (Howlett and Flemming, 1984). Moreover, [35S]GTPyS binding
assays on Cb1 demonstrate high affinity to Gαi proteins (Priestley R, et al., 1998). Cb1mediated retrograde inhibition of presynaptic neurons occurs through both the
downstream inhibition of cAMP/PKA via Gαi/o , and activation of G-protein inwardlyrectifying K+ channels (GIRKs) and inhibition of N-type, P/Q type Voltage gated
calcium channels via Gβ/γ. Presynaptic calcium inhibition and the efflux of K+ through

22

GIRKS limits the excitatory or inhibitory response on the post synaptic neuron by
hyperpolarizing the presynaptic membrane (Sudhof and Starke, 2004).
More recently, the crystal structure of a signaling cannabinoid receptor 1 protein
complexed with a Gαi protein has recently been solved (Krishna, K. et al., 2019). Indeed,
support from these studies are what form the basis of this canonical view of Cb1
signaling. However, the canonical view of GPCR signaling fails to explain the
differential signaling patterns in the Cb1 receptor.
The Cb1 receptor can activate different signaling pathways depending on the receptor
conformation induced by the activating ligand, a phenomenon known as functional
selectivity or biased agonism. For example, Lauckner et al. compared intracellular Ca2+
response in HEK-293 cells stably transfected with Cb1 after treatment with different Cb1
agonists. Upon treatment of transfected HEK-293 cells with the synthetic agonist
WIN55,212-2 (WIN), a transient influx of Ca2+ was recorded. This response was still
present after cotreatment with Gαi sensitive PTX (Lauckner, J. 2005). The response was
blocked when cells were treated with Phospholipase C inhibitors, suggesting that the
response may also be mediated by Gq Proteins.
Offering more compelling evidence for functional selectivity, a study conducted by
Diez alarcia et al. in 2016 revealed that Cb1 can couple to the classic inhibitory Gαi/o
proteins, in addition to different Gα subunits like Gαz, Gαq/11 and Gαq12/13 in a ligand
specific manner. Using a combination of GTP γ biding assays and antibodies to specific
Gα subtypes, it was determined that activation of the receptor by different ligands can
significantly alter its response (Diez Alarcia R. et al.,2016). By using specific antibodies
targeted to different inhibitory Gα proteins, Diez-Alarcia demonstrated the variability in

23

Gα protein coupling in response to the activation by a single ligand. These results imply
that Cb1 is capable of coupling to different G protein subunits in a way that cannot solely
be explained by functional selectivity or cellular context. Table 2 shows a non-exhaustive
list of the multiple levels of signaling pleiotropy in the Cb1 receptor.
4. The Gγ subunit
4.1. Biology of the Gγ Subunit
Assembly of the G-α β γ heterotrimer is a key step in the G-protein signaling
cascade. With 16 α subunits, 5 β subunits, and 12 γ subunits, there are 960 different
combinations of possible Gαβγ heterotrimers. Considering that many of these
associations are physically possible, (Richardson and Robishaw 1999), the presence of
preferential Gαβγ combinations that occur in specific cellular contexts offers support for
a functional role for the γ subunit in eliciting a physiological response.
In contrast to their β subunit counterparts and arguing against an eponymous
“Gβγ dimer,” the γ subunits exhibit more variation in amino acid homology and tissue
specific distribution suggesting an emergence of distinct functions. The current repertoire
of 12 g subunits (coded for individual genes) diverged from 5 ancestral subunits to form
the following classes—Class I: Gγ7 and Gγ12; Class II: Gγ2, Gγ3, Gγ4, and Gγ8; Class
III: Gγ5 and Gγ10; Class IV: Gγ1, Gγ9 and Gγ11; Class V: Gγ13 (Kahn 2013,
Syrovatkina et al.,2016).
4.2. Specificity of the g subunit
Sensory cells offer a great example of how signaling specificity can be achieved
through the actions of individual Gγ subunits. This was demonstrated early on when Peng
et al., showed an absolute requirement for Gαt1, β 1 and γ 1 for night vision in retinal rod
24

cells and G αt2β3γ8 for color vision in retinal cone cells (Kolesnikov et al., 2011; Peng et
al., 1992). It was later determined through gene knockout studies that loss of Gγ1 effects
membrane localization of the Heterotrimeric G-protein complex and subsequent
degradation of Gαt1 (Lobanova et al., 2008). Similarly, Kerr et al., demonstrated a novel
role for Gαolfβ1γ13 in olfactory neurons that are responsible for eliciting olfaction.
Whereas transcription is often the main driver for the assembly of preferential
heterotrimeric complexes in sensory and other specialized cells, it is unlikely the case in
many other cell types that express an array of G-proteins and yet still have specialized
functions. Compelling evidence for a post-translational mechanism governing the
assembly of distinct Gαβγ heterotrimers first came about in 2003 when researchers at the
Weis center for research used reverse genetic approaches to generate Gng7-/- knockout
mice and show a novel role for γ7 in D1 dopamine and A2a Adenosine receptor signaling
in the rat striatum (Schwindinger 2003, 2010). Quantitative immunoblot analysis
revealed that these mice showed a stoichiometric reduction of Gαolf and Gβ2 proteins in
the cytosol and membrane extracts, while the levels of their mRNA transcripts remained
unchanged. These mice also exhibited distinct phenotypes. For instance, Gng7-/- exhibit
a reduction in AC activity and a particular behavioral phenotype that is consistent with
complete or partial loss of reward and locomotive related behaviors. Researchers
speculated that because heterotrimer association to the membrane is facilitated by binding
of the Gα subunit to the Gβγ dimer, loss of γ7 prevented upstream receptor recognition
and subsequent membrane association and was therefore sent for protein degradation.
Thereby preventing G-protein-effector coupling following receptor activation. Further
arguing against transcription as being the sole mechanism responsible for the selective

25

assembly of Gαolfβ2γ7, the analysis also revealed g2 as being more abundant than g7 in the
striatum. Moreover, targeted knockout of G αl-/- in rat striatum does not lead to a
reduction of β2 and γ 7 proteins (schwindinger et al.,2010). These results demonstrate the
hierarchical order of heterotrimer assembly in rat striatum that is governed by the γ7
monomer in a post-transcriptional mechanism. Indeed, these studies identifying distinct
Gαβγ combinations responsible for specific physiological functions may provide a basis
to explain biased agonism and functional selectivity. Moreover, these studies provide a
basis for our hypothesis that individual Gγ subunits can alter signaling to downstream
effectors.
4.3. The g3 subunit
Gγ3 is encoded for by the Gng3 gene found on chromosome 11 locus p11 and
contains 2 exons in humans (Hurowitz 2000). Gγ3 is widely expressed throughout the
brain in many organisms and share around 80% amino acid homology with Gγ2 and Gγ4.
Zebrafish Gγ3 subunit shares a high degree of homology with humans and other
mammalian Gγ3 subunits. Of all the Gγ proteins, the zebrafish Gγ3 protein is most
closely related to its mammalian homolog sharing a 93% identical polypeptide sequence
(Kelly 2001, 2008). The regional distribution of Gγ3 in the mammalian brain was first
identified in 1997 and later in 2008 using immunohistochemical analysis of human
(Morishita 1997) and rat brain tissue. While Gγ3 is ubiquitously expressed in the
developing CNS and neural crest, these data provide a basis for our hypothesis that gng3/- fish may have an altered startle in response to acoustic stimuli. These studies revealed
strong localization of Gγ3 in the neuropil and inner ear, with little expression in the
neuronal cell bodies. Importantly, it was also observed that the levels of G γ 3 increased

26

in the developing CNS and neural crest and that these levels decreased in humans with
old age.
In 2001, Kelly et al., used whole-mount in situ hybridization and RT-PCR to
determine the expression profile of Gγ3 during zebrafish embryogenesis. Gγ3 was first
detected at 18-19hpf (late somitogenesis) where it was preferentially expressed on the
Cranial nerve V. Preferential expression of G γ 3 was detected in distinct neuronal
populations of the fore-, mid- and hindbrain. These signals were localized to the
developing neural tissue and appeared to follow a similar expression profile to GABA
and Acetocholinesterase (AChE) expressing neurons. Importantly, overexpression of B2
γ 3 resulted in defects in eye and forebrain development. Thus, the spatial and temporal
expression pattern of G γ 3 indicates a possible role in transducing signals in the
developing nervous tissue (Kelly et al.,2001)
The first example of a gene silencing approach used to determine function of an
individual g subunit occurred in 1993 when Kleuss et al., used gng3 specific anti-sense
oligonucleotides in a rat pituitary cell line to show a requirement for G γ 3 in mediating
Ca2+ influx through L-type Ca2+ channels in somatostatin and muscarinic receptor
signaling (Kleuss C et al.,1993). Using a similar gene targeting approach, Macrezlepretre 1997, demonstrated that angiotensin induced activation of At1 receptors and the
subsequent increase in intracellular calcium was dependent on G α 13/ β 1/ γ 3-effector
coupling. Moreover, this study demonstrated that knockdown of any one of the G α
13/β1/γ3 G protein monomer abolished Gαt1 mediated increases in intracellular calcium
(Macrez-lepretre 1997).

27

More recently, the Gng3(-/-) phenotype in murine models has been implicated in
effecting opioid signaling, likely by altering the mu-opioid (Oprm1) signaling cascade
(Schwindinger et al., 2004 , Schwindinger et al., 2009). In the first set of experiments
conducted by Schwindinger, et al., investigators used a gene deletion method that
resulted in the generation of Gng3-/- mice. When compared to the control group, the
Gng3 -/- group presented with an increased seizure susceptibility (when induced by an
85-95 dB sound for 10 seconds), and a higher mortality rate. Female Gng3 -/- mice
showed a reduction in weight gain, decreased adiposity and lower leptin levels when
compared to female controls. These results led the researchers to the conclusion that the
Gng3-/- phenotype exhibits both neurological and metabolic abnormalities.
In line with their previous findings, Schwindinger, et al., sought to determine
whether the lean phenotype observed in Gng3-/- mice may be a result of defective Oprm1
signaling. A high fat diet was fed to both treatment and control phenotypes. Gng3 -/mice show resistance to high fat diet-induced weight gain compared to control. Gng3 -/mice also showed reductions in both acute and chronic morphine responsiveness in
addition to increases in mRNA levels of encephalin (Penk) in reward-specific brain
regions in the midbrain. It is important to note that no differences in Cb1 stimulated
GTPγS binding or AC activity was observed in the Gng3-/- mutants. However, the sole
purpose of this study was not to characterize Cb1 signal transduction, and researchers
only looked at specific reward-related brain regions.

28

Methods
1. Plasmid and bacterial protocols
The human Cb1 receptor variant 1 (CNR1) and the human wild-type Gγ3 (GNG3)
were obtained as clones in pcDNA3.1+ at Kpn I (5’) and Xho I (3’), and at EcoR1 (5’)
and Xho I (3’) (cDNA Resource Center, Bloomsburg, PA), respectively (Figure 3). The
pcDNA3.0 vector encoding EGFP was purchased from Addgene (Watertown, MA). All
cloned genes were expressed under the mammalian CMV promoter and plasmids were
selected for using an ampicillin resistance marker (Figure 4).
Luria-Bertani (LB) broth and agar (Sigma-Aldrich, St. Louis, MO) was prepared
by dissolving 25g, and 20g of LB-broth and LB-Agar powder per 1L of water. Solution
was sterilized and melted by autoclaving at 121 C and 15 PSI for at least 15 minutes. LB
was allowed to cool and supplemented with 100ug/mL of ampicillin (Sigma-Aldrich) for
broth and agar plates.
Competent 5-alpha High-Efficiency E. coli cells (New England Biolabs, Ipswich,
MA) were used to amplify plasmid DNA (pDNA) according to manufactures protocol. In
brief, competent cells were allowed to thaw on ice for 10 minutes followed by the
addition of ~500 ng of plasmid DNA (pDNA) to the tube. The cell solution was then heat
shocked by incubating the tube at 42°C for precisely 30 seconds and stored on ice for 5
minutes. The solution was diluted with SOC media and allowed to incubate at 37°C for
60 minutes while shaking at 250rpm. Two 10-fold serial dilutions in SOC media were
performed on the mixture before plating onto several LB-Ampicillin selection plates. The
plates were then incubated at 37°C for 24 hours and checked for single colony formation.
An inoculation loop was flame sterilized and used to isolate a single bacterial colony. The

29

colony was transferred to a conical tube (USA Scientific, Orlando, FL) containing
LB+ampicillin (100ug/mL). The liquid cultures were incubated at 37°C for 24 hours in a
shaker incubator set to 250 RPM and were used to generate concentrated plasmid stocks.
Liquid cultures were used to generate glycerol stocks for archival and long-term storage
of transformed bacteria. A 50% glycerol solution was prepared by combining equal parts
molecular biology grade glycerol (Sigma-Aldrich) and sterilized deionized H2O. Equal
parts of bacterial liquid culture and glycerol solution were mixed in a cryovial and stored
at -80°C.
According to the manufacturer's instructions, the GenElute plasmid miniprep kit
(Sigma-Aldrich) was used to extract plasmids from liquid bacterial cultures. In brief, 5ml
of the overnight recombinant E. coli culture was pelleted at 12,000 x g for 1 minute, and
the supernatant was discarded. The pellet was resuspended in the supplied resuspension
solution and vortexed until a homogenous solution was achieved. Lysis was achieved by
the lysis solution to the mixture and carefully mixing it. Lysis was allowed for 5 minutes
at room temperature using the supplied lysis solution. Lysis was neutralized by adding
the neutralization solution. The cell debris were precipitated and pelleted via
centrifugation at 12,000 x g for 10 minutes. Next, the lysate was transferred to an
assembled nucleic acid binding column and centrifuged at 12,000 x g for 1 minute. The
flow-through liquid was discarded, and the column was washed with the supplied EtOHdiluted wash solution and centrifuged at 12,000 x g for 1 minute. The flow-through was
discarded, and the column was allowed to dry by centrifugation at 12,000 x g for 2
minutes. Next, the binding column was transferred to a collection tube. The DNA was
eluted from the column using the elution solution centrifuged at 12,000 x g for 5 minutes.

30

The concentration and purity were quantified using a NanoDrop-1000 UV-Vis
Spectrophotometer (Thermo Fisher Scientific).
2. Ethanol precipitation of pDNA products
Plasmid DNA was ethanol precipitated from solution to obtain a final [pDNA] of
0.5 ug/uL and A260/A280 between 1.8-1.9. From each sample, a 1uL sample was used to
measure DNA concentration and purity via Spectrophotometry with a NanoDrop-1000
UV-Vis Spectrophotometer. For each ethanol precipitation reaction, 0.1 volumes of 3M
Sodium-Acetate (Sigma-Aldrich), and 2.5 volumes of cold 100% EtOH was added to the
DNA solution to achieve a final salt concentration of 0.3M and EtOH of 70%. The
solution was mixed briefly and centrifuged at 20,000 RPM for 10 minutes at 4°C. Next,
the supernatant was removed and the pellet was washed with 70% EtOH and centrifuged
at 20,000 RPM for 5 minutes at 4°C. The pellet was allowed to dry and resuspended in
the appropriate volume of solution to obtain a final [pDNA] of 0.5 ug/uL, Following the
resuspension of the precipitated DNA, a 1 µL sample was used to verify concentration
and purity using a NanoDrop Spectrophotometer.
3. Restriction enzyme digestion
Plasmid identity was verified by restriction enzyme digest. The plasmid map was
examined for restriction sites with the webtool NEBcutter V2.0 (NEB). For each
digestion, 500-700 ng of pDNA was digested with the appropriate restriction enzyme.
pDNA containing gng3 was digested with XHO1 and HINDIII using the 10 NEB2.1
buffer. pDNA containing Cnr1 was digested with XhoI and EcoR1 using the 1x NEB2.1
buffer. pDNA containing EGFP was digested with XmnI using the 10x CutSmart buffer
(NEB). The digestion mixtures were heated to 37°C for 1 hour, and the enzymes were
31

inactivated by heating to 65°C for 15 minutes. The resulting digest was run on a 0.8%
agarose gel and imaged using a ChemiDoc imager (BioRad, Hercules, CA) at 320 nm
wavelength and verified for the presence of the corresponding insert.
4. Genomic DNA Isolation from Danio rerio
According to manufactures instructions, genomic DNA Isolation from Danio
rerio was isolated using the GenElute Mammalian Genomic DNA Miniprep Kit (Sigma).
All zebrafish embryos and juveniles were stored at 4°C before isolation. More than 25
mg of tissue was suspended in Lysis T solution supplemented with 20 mg/mL of
proteinase-K, vortexed thoroughly to break up tissue, and digested at 55C for 3 hours.
Samples were removed and vortexed every 30 minutes for ~15 seconds. Following
incubation, samples were treated with RNase A at room temperature for 2 minutes. Lysis
was achieved following the addition of Lysis C solution and an incubation period of 10
minutes at 70°C. 100% Ethanol was added to the lysate. The Lysate was then transferred
to a preassembled binding column and centrifuged at 12,000 x g for 1 minute. The flowthrough was discarded, and the lysate was loaded into the column. The spin column was
washed twice with the supplied wash solution. The spin column was transferred to a new
collection tube, and Elution Solution was added to the column and centrifuged for 1
minute at 8,000 x g to elute the DNA. The purity and concentration of the eluant were
quantified using a Nanodrop Spectrophotometer at wavelengths of 260/280 nm.
5. RNA and cDNA preparation
RNA was extracted from CHO-K1 cells and Rat brain (positive control) using the
TRIzol reagent (Sigma-Aldrich) to determine the expression of Cnr1 and Gng3. CHO-K1
cells were plated on a 60mm culture dish 3-4 nights before RNA extraction. When cells

32

reached 80-90% confluency, the cell medium was aspirated, and the TRIzol reagent was
added directly onto the cell monolayer. After a 5-minute incubation period at room
temperature, cells were pipetted up and down to lyse cells and placed into a 1.5 mL
centrifuge tube. For RNA extractions using rat brain, 50-100 mg of tissue was suspended
in 1 mL of TRIzol. The sample was homogenized on ice using a cordless motor pellet
pestle (Sigma). Chloroform (Sigma) was added directly to the tube at a 1:5
chloroform:TRIzol ratio and centrifuged at 12,000 x g for 15 minutes at 4°C. The upper
aqueous phase containing the RNA was removed from the sample and transferred into a
new 1.5 mL tube. To precipitate the RNA from the aqueous phase, 100% isopropanol
(NAME) was added into the tube at a 1:2 Isopropanol:TRIzol ratio and left to incubate at
room temperature for 10 minutes. Next, samples were centrifuged at 12,000 x g for 10
minutes at 4°C. The supernatant was removed from the tube, and the RNA pellet was
washed with 75% ethanol at a 1:1 TRIzol:Ethanol ratio. The sample was vortexed briefly
and centrifuged at 7,500 x g for 5 minutes at 4°C. The supernatant was removed, and the
RNA pellet was left to air dry for 1.5 hours. The RNA pellet was resuspended in
nuclease-free water. The concentration and purity of the RNA samples were measured
using a NanoDrop Spectrophotometer at wavelengths of 260/280.
First-strand cDNA was prepared from 1ug of total RNA primed with Oligo (dT23
using 1x ProtoScript Reverse Transcriptase and 1x ProtocoScript II reaction mix (NEB).
The reaction was initiated by incubating the samples at 42°C for 1 hour and inactivated at
80°C for 5 minutes.
6. Single guide RNA (sgRNA) design

33

The UCSC Genome Browser (http://www.genome.uscs.edu/) was used to locate
the genomic DNA sequence of gng3 from the Zebrafish Assembly May 2017
(GRCz11/danRer11). The DNA sequence was used to design a single guide RNAs
(sgRNAs) to target the second coding exon, exon 3, of the g3 subunit (Figure 5). The
regions containing the sequence of interest were entered into the CRISPR Genome
editing tool from Integrated DNA technologies (IDT;
https://www.idtdna.com/site/order/designtool/index/CRISPR_CUSTOM). The sgRNA
sequences were chosen based on the ones that had the highest efficiency on target score
and off target scores. The PrimerQuest Tool from IDT was also used to design genomic
DNA primers that flanked the Cas9 cut site.
7. Polymerase Chain Reaction
PCR amplifications were performed in 25uL reactions with approximately 40-120
ng of DNA, 1x Taq DNA polymerase (Takara bio ), 1x Taq Reaction Buffer (Takara bio),
0.2mM dNTPs (sigma), 20 uM of forward and reverse primer (IDT) in nuclease-free
water. All reactions were performed with a negative control by replacing DNA with
nuclease-free water. PCR conditions were optimized to produce a single band by
adjusting the concentration of DNA, annealing temperature, and number of cycles. PCR
conditions and primers are shown in Table 3.
8. Agarose gel electrophoresis
1.5% agarose gel electrophoresis was performed in 1x TAE buffer (SigmaAldrich). PCR products and water blanks were resuspended in 1x purple Gel Loading
Dye (New England Biolabs) and loaded into the gel. The gel was run for approximately

34

30 minutes at 100 volts. Gels were imaged using a ChemiDoc imager (BioRad) at a
wavelength of 320 nm.
9. Sequence analysis
Verification of gene targeting was assayed using amplification by PCR followed
by Sanger sequencing and deconvolution analysis. Intron-spanning primers AP07-AP08
were designed to flank the Cas9 cut-sites to allow for amplification of the target region
(Primer table). Genomic DNA extracted from the crispants and amplified using primers
AP07-AP08 was run on a 1.5% agarose gel. The gel was analyzed for heteroduplex
banding or smearing at the area corresponding to the size of the amplicon. These samples
were selected to be sequenced.
According to the manufacturer's instructions, PCR products were treated with
ExoSAP-IT (NEB) at a Ratio of 5:2 PCR product:ExoSap to remove the residual dNTPs
and primers. Briefly, the samples were diluted in the ExoSAP-IT and incubated at 37°C
for 15 minutes. The ExoSAP-IT was inactivated by incubation for 15 minutes at 80°C.
Each sample was mixed with the forward or the reverse primer and sent to GENEWIZ
(South Plainfield, NJ) for sequencing. The results were analyzed using the Interference of
CRISPR Edits (ICE) tool (Synthego; https://ice.synthego.com/).
10. Fura-2AM Calcium Assay
G-protein coupling to the receptor complex was characterized using fluorophores
that bind to calcium presumably released from the ER, a key feature of a GPCR inducing
a Gq-like response. Culture media was removed, and cells were loaded with 7.5uM Fura2AM in DMEM without phenol red. Cells were incubated in the loading solution for 1
hour at 37°C and 5% CO2. Cells were then washed twice with 1ml of basic salt solution

35

(BSS). BSS is comprised of 130mM of NaCl, 5.4mM of KCl, 5.5mM glucose, 2mM of
CaCl22H2O, 20mM HEPES, and 1mM MgCl2 that was adjusted to a pH of 7.2 by
titrating 10M NaOH. After the cells were loaded, the solution was removed from the cell
monolayer, placed in 1mL BSS, and incubated at room temperature in the dark for 20
minutes. Cells were then placed on the calcium imaging system, and background
fluorescence was collected for at least 30 seconds. The time was marked, and cells were
stimulated with 1mL of 10uM AEA (Cayman). Calcium was measured using an InCyt
Basic Fluorescence Imaging System, kindly provided by Dr. Robert Aronstam, and
acquired from Intracellular Imaging of Cincinnati, Ohio. An Olympus Uis2 20x
objective, acquired from Olympus Corporation of the Americas of Shinjuku, Japan, was
used with the imaging system to measure the changing ratio of 340nm and 380nm
wavelength emitted by the bound and unbound Fura-2AM. Fluorescent intensity was
measured at 510nm.
11. Cell culture and Transfections
Chinese Hamster Ovary (CHO) cells (ATCC) were cultured in Dulbecco's high
glucose modified medium (Sigma) supplemented with 10% fetal bovine serum (FBS),
0.5mM L-glutamine (sigma), 0.1 mM sodium pyruvate (Sigma) and 1%
penicillin/streptomycin (P/S) in non-pyrogenic 60-mm tissue culture-treated dishes (USA
scientific). Cells were maintained at 37°C and 5% CO2 in an incubator and kept at a low
passage rate. The cells were sub-cultured every 4 or 5 days when 80-90% confluency was
reached. To subculture cells, the growth medium was aspirated, and the cells were rinsed
twice with 1x Phosphate-buffered saline (PBS) (sigma). Cells were detached using 0.25%
trypsin, 1 mM EDTA (Thermo Fisher Scientific) and seeded into a new dish. Cells were

36

cryopreserved and frozen at a slow rate of -1°C per minute using Nunc cryovials and
culture media supplemented with 5% dimethylsulfoxide (DMSO) (Sigma) in a -80°C
storage freezer. Cells were transferred and stored in vapor-phase liquid nitrogen for
archival and long-term storage.
For experiments involving the expression of Cb1, gng3, or EGFP, cells were
transiently transfected using the electroporator according to manufactures instructions. In
brief, cells were seeded into a 60mm dish with DMEM+10%FBS+1%P/S two days prior
to transfection. Cells were washed twice with an equal volume of PBS and detached from
plates using a 0.1% Trypsin-EDTA solution after reaching 75-85% confluency. For all
transfections, 1x10^6 cells were pelleted and resuspended in nucleofection solution
(Lonza). The cell suspension and 2.0 ug of pDNA were added into the cuvette and
transfected using the H-014 nucleofector program. Immediately following
electroporation, cells were transferred into 600ml of pre-equilibrated DMEM. pcDNAEGFP was used as a positive control to confirm that the nucleofection had been
successful and as a standardized variable to keep the concentrations of DNA for
transfection the same.
12. cAMP measurement
G-protein coupling to Adenylyl cyclase was measured using the cAMP-Glo™
Luminescence Assay (Promega) following manufactures instructions. In brief, transiently
transfected CHO-K1 cells were seeded into a 96-well black plate (Thermo) at a density of
~6.25x10^4 cells/well in 200ul of growth medium. Immediately prior to assaying, the
medium was aspirated and cells were washed with twice with phosphate-buffered saline
solution to remove traces of serum. Cells were then treated with 20uL of their respective

37

1x agonist (ANA, FSK, ANA+FSK, and Induction buffer) for 10 minutes at room
temperature using a shaking plate (Thermo). Next, lysis of the cells was achieved by
adding the supplied cAMP-Glo™ Lysis Buffer and incubating for 20 minutes at room
temperature on a shaking plate. Then, the PKA reagent containing the PKA substrate and
holoenzyme (cAMP-Glo™ Reaction Buffer) was dispensed into each well . The kinase
reaction was carried out for 20 minutes at room temperature. Finally, an equal volume of
Kinase-Glo Reagent (80uL/well) was added and allowed to incubate for 10 minutes.
Luminescence was read using a BioRad plate reader. To establish a semi-quantitative
measurement of cAMP, the DeltaRLUvalues were calculated by subtracting the average
RLU for each triplicate by the average RLU value of cells treated with the induction
buffer.
Agonist preparation:
Agonists were freshly prepared the morning of each experiment. 2ArachadonylEthanolamide (Anandamide) was purchased from Cayman Chemicals
(Batch #0525560-30) at a stock concentration of 14 mM. A 4x working solution was
prepared by removing 1uL of the stock solution and diluting it in 3.6 mL of PBS. The
solution was then diluted in the induction buffer containing PBS and 1 mM isobutyl-1methylxanthine (IBMX) (Enzo), a potent phosphodiesterase inhibitor, to obtain a 1 uM
concentration used for treatment.
Forskolin was obtained from EMD Millipore Corp, USA, (lot#3387887) at a stock
concentration of 50mM. A 4x working solution was prepared by removing 1uL of
Forskolin and diluting it into 250uL PBS. The solution was then diluted in the induction

38

buffer containing PBS and 1 mM IBMX to obtain a 50uM concentration used for
treatment.
13. Fish care and Embryo rearing
All protocols involving animals were approved by the Bloomsburg University of
Pennsylvania Institutional Animal Care and Use Committee (IACUC #172). Adult fish
(The Fish Place, Lancaster PA) were maintained in our facility's freshwater fish room.
After purchasing, fish were quarantined for two weeks, and the tank water was treated
with a prophylactic dose of Microbe-Lift (Ecological laboratories) and NITE-out
(Ecological laboratories). Initially, the water chemistry was checked daily using an API
Freshwater Master Test Kit. After water quality remained stable for two weeks, water
chemistry was monitored daily. Water pH was maintained between 7-8, alkalinity
between 50-100 mg/L, hardness at least 75 mg/L, and nitrogenous waste less than 0.02
mg/L (Harper and Lawrence, 2011). Fish were maintained on a 14:10 day/night light
cycle to induce spawning. Water temperature was maintained at 28°C, and an air pump
was used to oxygenate the water. Tank water was filtered through a reverse
osmosis/deionized (RO/DI) filtration system (Spectrapure) and delivered automatically to
each aquarium from a holding tank. A water conditioner (Aqueon) was added as needed.
14. Spawning and Embryo Rearing:
Fish used for breeding were between 7-12 months of age and were housed
together in the same tank. Crosses were set up the evening prior to embryo rearing by
placing single male and female fish separate in a divided breeding tank. The dividers
were lifted 20 minutes prior to the lights turning on. The fish were given approximately

39

20 minutes to spawn before embryos were collected. If no embryos were present at 20
minutes, fish were allowed an additional 20 minutes to spawn.
15. Validation of a behavioral paradigm to measure startle and locomotor activity
after sound challenge.
Zebrafish juveniles (7dpf) were placed individually in wells (2inx2in) containing
6ml of 1x egg water or 1x egg water treated with either low dose ANA (10uM) or highdose ANA (40uM). Doses were modified from those used by Sufian et al., 2018.
Juveniles were submerged in their appropriate solution for a treatment period 15 minutes
prior to assaying and remained in the solution throughout the experiment. A video camera
(12MP iPhone 13 Pro Max) was mounted above the assaying dish on a ring stand. Fish
were recorded for 2.5 minutes to establish a baseline activity level before a brief acoustic
stimulus of 120 Db (Shoreline Marine Airhorn) was delivered 1 meter away from the
experimental setup. Fish were then recorded for an additional 2.5 minutes to measure
locomotion. The video was imported into VLC and frames were extracted (10
frames/second). (Note: This step was to reduce the frame rate to a manageable amount
that was used for a frame-by-frame analysis.) Frames were then imported into ImageJ and
the video was converted into 8-bit grayscale and made binary by adjusting the threshold
to create a clear distinction between the juveniles and the background. The region of
interest was selected, and movement data was processed individually for each well. The
area of interest and x and y coordinates were imported into excel for analysis.
16. Validation of a Behavioral assay to measure startle and locomotor activity after light
challenge

40

Zebrafish juveniles (7dpf) noninjected wild-type or juveniles injected with GFP
were placed individually in wells (2inx2in) containing ~4mL of 1x egg water. Fish were
allowed to acclimate to their new environment for 10 minutes with the lights on high
intensity. A video camera (12mp iPhone 13 Pro Max) was sitting 18 inches above the
assaying arena. The fish were recorded for a total of 16 minutes: 4 minutes with the
lights on high intensity to establish baseline locomotion, 4 minutes with the light at low
intensity (dark challenge), and then 8 more minutes with the lights on high intensity. The
video was imported into VLC and frames were extracted (2 frames/second). The frames
were divided into the 3 phases (Light:Dark:Light , 4min:4min:8min) and imported
separately into imageJ. The video was converted into 8-bit grayscale and made binary by
adjusting the threshold to create a clear distinction between the juveniles and the
background. The region of interest was selected, and movement data was processed
individually for each well. The Area of interest and X and Y coordinates were imported
into excel for analysis.
17. Preparation of CRISPR-reagents for Microinjection
The Alt-R CRISPR-Cas9 system was purchased from IDT. The Alt-R crRNA
(guide) and tracrRNA was supplied as a lyophilized powder and were resuspended in the
appropriate volume of Nuclease-Free IDTE buffer to reach a final working concentration
of 100uM. Assembly of the Ribonucleoprotein complex occurred in the mornings within
1 hour before injections. First, a 3uM gRNA solution was assembled by combining 3uL
of 100uM Alt-R CRISPR-Cas9 crRNA, 3uL of 100uM Alt-R CRISPR-Cas9 tracrRNA,
94 uL of Nuclease-Free Duplex Buffer, and heated for 95 C for 5 minutes. Next, the Cas9
protein (10ug/uL) was diluted to a working concentration of 0.5 ug/uL by combining

41

0.5uL of the Cas9 protein with 9.5uL of the Cas9 working buffer (20mM HEPES;
150mM KCL, pH7.5) Note: The increase of ionic strength and addition of KCl has been
shown to increase the solubility of the Cas9 protein and increase cutting efficiency
(Burger et al., 2016). Finally, assembly of the RNP complex was accomplished by
combining 3uL of the gRNA with 3 uL of the diluted Cas9 protein and incubated at 37°C
for 10 minutes.
18. Microinjection of CRISPR-components into Zebrafish Embryos
All microinjections were conducted using a Narishigi Nikon
Micromanipulator/Microinjection system (Model IM-9b). Calibration of the machine was
required to determine the amount of injection solution was being delivered. We used a
calibration micrometer slide (Amscope) with a large drop of mineral oil placed over the
scale. Methylene blue was backloaded into the needle and injected into the oil droplet.
This was repeated until a consistent 0.15 mm droplet diameter (contains approximately
2nL-3nL of solution) was achieved.
Embryos were collected using a 1ml plastic pipette, washed with 1x egg water containing
60 ug/mL of instant ocean salt in sterilized dH2O, and transferred to a 10cm petri dish
(Thermo) filled with room temperature egg water. Approximately 10-15 embryos were
lined up against a glass slide in a petri dish and viewed under low magnification to ensure
that the embryos were not developed past the 2-cell stage (Figure 6). It is recommended
that the microinjection solutions contain the Cas9 protein and sgRNA in a 2:1 ratio of
Cas9:sgRNA to obtain a final concentration of 400pg/nL of cas9 protein and 200 pg/nL
of sgRNA and injecting 1nl of solution (sorien, et al.,2018). For our experiments, we
used a final concentration of 103 pg/nl sgRNA (crRNA is 36 ng/uL and 67 ng/uL

42

tracrRNA) and 0.5 ug/ul of Cas9 protein and delivered ~2nl of solution into the embryo
yolk sack. The solution contained 0.08% Phenol red for visual confirmation of the
injection. Following the injection, embryos were returned to their incubator tank to
develop. Embryos were imaged daily using to inspect the health, calculate survival and
remove the dead embryos from the tank.
A 1mm capillary tube (World Precision Instruments) was pulled using a P97
needle puller (Sutter instruments) We used the following program to create a tip suitable
for injection: Pressure = 400, Heat=512+Ram, Pull= 125, Vel= 075 , Time=200. The tip
of the needle was swiped with a KimWipe (Fisher) to obtain an angled opening that could
easily pierce the chorion.

43

Results
1. Expression analysis of gng3 and Cnr1 in CHO-K1 cells
To establish a model system that will allow me to analyze the effect of the forced
expression of GNG3 and CNR1, the endogenous expression levels of Gng3 and Cnr1
were determined by performing PCR on the cDNA synthesized from RNA extracted from
CHO-K1 cells, and Mesocricetus auratus (hamster) brain as a positive control.
Gng3 is most abundantly expressed in the brain, while Gng10 is more
ubiquitously expressed throughout many tissue types (Syrovatkina et al., 2016).
Moreover, Cnr1 is also widely distributed in many tissue types. Following the
optimization of PCR conditions, primer pair AP03-04, WS93-94 and WS99-100 were
used to amplify the prepared cDNA from hamster brain and CHO-K1 cells to determine
the expression profiles of Cnr1, Gng3 and Gng10, respectively. Our results show that the
gng3 and Cnr1 transcripts are expressed in hamster brain but not in CHO-K1 cells . The
Gng10 transcript was present in both hamster brain and CHO K1 cells (Figure 7). This
makes CHO-K1 cells an ideal model system to use for identifying the role that gng3
plays in Cnr1 mediated signal transduction.

2. Concentration of DNA for transfection
The concentration of the pDNA is important for optimal transfection efficiency.
For transfections using the Amexa Electroporation system, an OD 260/280 of 1.7-1.9 and
a concentration of DNA that would allow for 2ug plasmids/sample in 4uL of water is
recommended by the manufactures. To accomplish this, the initial pDNA concentration
and purity was determined using a NanoDrop1000 (data not shown). The pDNA was

44

cleaned and concentrated using a sodium acetate-ethanol precipitation to reach a final
pDNA concentration of ~500ng/ul and OD of 1.7-1.9 . Transfection efficiency via
electroporation was determined by co-transfection of a plasmid that expresses EGFP in
parallel to cells transfected with Cb1 and Gng3 in all assays.
3. Restriction Enzyme Digest
A restriction enzyme digest was used to verify the identity of the plasmids that
were isolated from E. coli. Gng3 and Cnr1 were cloned into the pcDNA3.1+ vector and
EGFP was cloned into the pcDNA3 vector (Figure 4). Inserts corresponding to the
expected product lengths were visualized on a 1% agarose gel stained with EtBr (Figure
8).
4. Validation of the cAMP-Glo assay
Cannabinoid receptor agonist-mediated inhibition of Fsk stimulated cAMP accumulation
in a classical Gi/o dependent manner is a hallmark trait of the Cb1 receptor. While there
are different ways to measure cAMP accumulation, we chose a PKA-dependent reporter
assay that is dependent on the concentrations of [ATP]. A cAMP standard curve was
generated at concentrations ranging from 0-4uM. Standard curves were also generated in
other 96-well plates to determine which was best suited for assaying. Standard curves
were generated using 96-well black plates were linear at [cAMP] ranging from 0-0.125
uM (Figure 11).
5. Does forced expression of gng3 alter cAMP accumulation in CHO-K1 cells?

CHO-K1 cells treated with Fsk, AEA, FSK+AEA, and a vehicle. An Analysis of
Variance reveled no significant difference between treatment groups (Pvalue=0.6286),

45

Thus, we reject our hypothesis that forced expression of Gng3 and Cb1 in CHO-K1 cells
will significantly alter cAMP accumulation when compared between treatment groups.
While no statistically significant differences exist between treatments, it is
important to note an obvious trend between cells transfected with Cb1 or Cb1+GFP and
treated with Anandamide. CHO-K1 cells expressing only the Cb1 receptor and treated
with AEA trended towards decreasing cAMP accumulation (when compared to basal
cAMP). However, when co-transfected with gng3 and treated with AEA—cAMP
accumulation tended to increase above basal levels.
6.

Measurement of intracellular calcium transients

The ability of Cb1r agonists to inhibit synaptic transmission through the
modulation of intracellular calcium transients is mediated by a variety of canonical and
non-canonical G-protein mechanisms. Studies using primary cell lines derived from
different types of neural tissue like Astrocytes (Hegyi,2018,), Rat Cerebellum (Daniel, et
al., 2004) and neuroblastoma cells (Sugiura 1999) demonstrate the ability of Cb1 to
activate IP3 release and subsequent release of intracellular Ca2++. In contrast, other
studies using CHO cells expressing Cb1 have failed to detect this response. Since the g3
subunit is preferentially expressed in the brain and has been found to be colocalized in
Cb1 expressing cells, we hypothesized that CHO-K1 cells expressing the g3 subunit
could evoke the release of intracellular calcium when stimulated with Anandamide. We
tested this by stimulating CHO-K1 cells transiently expressing recombinant Cb1 and
Cb1+gng3. Both groups were treated with 10um and 100uM uM AEA and failed to show
any change in intracellular calcium transits Leading us to reject our hypothesis that

46

forced expression of gng3 and activation of Cb1 will evoke the release of intracellular
calcium stores when stimulated with Anandamide (Figure 10).

7. Validation of a VMR Assay in zebrafish

A VMR assay was employed to measure the response of juvenile zebrafish in
response to a light and dark challenges. After 10 minutes of acclimating to their new
environment, WT juvenile zebrafish (7dpf, n=9) travelled 144±36 mm during 4 minutes
under continuous high intensity lighting (Phase 1) and 108±32 mm during 4 minutes
under continuous high intensity lighting (phase 3) following a period of 4 minutes at low
intensity lighting (phase 2). While fish trended to travel less following low lighting
conditions, these differences were not statistically significant (t test=0.217). The total
distance traveled under low intensity lighting (phase 2) was not obtained for the WT
group (Figure 11).
Considering this paradigm was intended for use on our zebrafish mutants, we wanted
to assure changes in VMR was not affected by our injections. A GFP plasmid was
injected into embryos immediately after fertilization in parallel to our non-injected WT
fish. GFP injected juvenile zebrafish (7dpf, n=8) traveled an average of 133±36mm in
phase 1, 173±52mm in phase 2 and 104±37 mm during phase 3. Distance travelled by
GFP mutants also tended to be less but was insignificant between phase 1 and 3 (ttest=0.200). However, distance travelled in phase 3 was significantly less than distance
traveled in phase 2 (t-test=0.030). Moreover, our results show no significant differences
between the distances WT and GFP in phase 1 (t-test=0.803) or phase 3 (T-test=0.911).
Thus, our GFP injections did not have a significant impact on distance travelled.

47

8. Validation of an Acoustic Startle Paradigm in Zebrafish Larvae (7dpf)

An acoustic startle assay was performed on zebrafish larvae, some of which had been
treated with Anandamide (10uM). An air horn was used as the acoustic stimulus (120dB)
and the distance traveled 0.33 seconds before the stimulus and 26.40 seconds after the
stimulus was calculated.
In trial 1, fish in the treatment group travelled and average of 3.246 mm (standard
error=0.066mm) before the blast and 54.841mm after the blast (standard
error=1.146mm). The control group in trial 1 travelled an average of 3.148 mm (standard
error=0.098 mm) before and 57.747 mm (Standard error=1.385 mm) after the blast.
Distance travelled in trial 1 was not significantly different between treatment and control
before (T-test=0.904) or after (t-test=0.726) the blast. Total distance travelled in trial 1
was also not significantly different between the treatment and control groups (ttest=0.741). The average startle latency in trial 1 was 0.136 seconds for the control and
0.099 seconds for the treatment group and this difference was not statistically significant
(T-test=0.26; Figure 12).
In Trial 2, Fish in the treatment group travelled and average of 2.602mm before
(standard error=0.0843) and 35.591mm (standard error=0.0843secs) after the blast.
Whereas, the control group traveled an average of 3.554 seconds before (standard
error=0.146) and 43.147 seconds (standard error=1.243 seconds) after the blast. The
distance travelled in trial 2 was not statistically significant between treatment and control
groups before (t-test=0.421) or after (t-test=0.376) the blast. The total distance travelled
in the experiment by the treatment vs control groups was also not significantly different (t
test=0.357; Figure 12).

48

To evaluate the reliability of our assay, tests for significance between trial 1 and trial
2 were conducted. Distance travelled between treatment and control in trial 1 and 2
before (t-test=0.536)and after (t-tests=0.356) the blast, and in total (t-tests=0.344) were
all insignificant (Table 4). This data suggests that are data was reliable between 2 trials
and allows us to reject our hypothesis that the distance travelled in zebrafish larvae would
be significantly affected by treatment with anandamide (10uM).
Significance in startle latency was analyzed by a Chi2 test between the frame the fish
first startled (moved two std. deviations above the average distance) showed no
difference between treatment and control groups ( X2 = 24.778, df = 25, p-value =
0.4749). Histograms of the distribution is shown in Figure 13.
9. Microinjections and CRISPR/Cas9

Primers were designed to amplify a 350bp amplicon that flanked the cut site
(AP11-12). Genomic DNA was isolated from the crispants and amplified using primer
pair AP11-12. The results in Figure 15 reveal a banding pattern that is consistent with an
indel formation. These samples were then sent out for Sanger sequencing and
chromograms were analyzed with ICE (Synthego) to determine genomic editing
efficiency. Sample 2-1 had the lowest editing efficiency with 12% (R2=0.98) of the total
alleles containing a 4bp deletion and less than 1% with a 10bp deletion. Sample 2-5
harbored the highest formation of indels with an editing efficiency of 93% (R2=0.99) of
the total alleles containing a 4bp deletion. Sample 2-6 had an editing efficiency of 72%
(R2=0.98) of the total alleles containing a mix of both insertions and deletions.

49

Discussion
1. Expression analysis of Gng3 and Cnr1 in CHO-K1 cells
One of the primary objectives in this study was to understand how Gg3 coupling to
the Cb1 receptor effected the activation of downstream signaling cascades. To do this, we
used a Chinese hamster cell line (CHO-K1) as a representative model to evaluate these
effects in vitro. The expression levels were characterized by using RT-PCR on the
mRNA isolated from lysed CHO-K1 cells. The cDNA obtained was amplified using
primers specific to Cnr1, Gng3 and Gng10. Gng10 was amplified as a positive control for
the PCR reaction and all PCR reactions were performed in parallel with cDNA obtained
from hamster brain as a positive control for the primers. Our data indicate that CHO-K1
cells do not endogenously express the Gng3 or Cnr1 transcript but do express the Gng10
transcript.
CHO cell lines are an epithelial cell line derived from the ovary in Chinese hamsters.
They are a robust cell line that is often used in biological and pharmaceutical research
because of their ability to produce recombinant proteins (Wurm et al., 2004). Moreover,
CHO cells allow for post-translation modifications to recombinant proteins that are more
similar to those in human cells, especially when compared to other on-the-market cell
lines (Ghaderi et al., 2012). This was an important factor in our studies considering the
post translational isoprenylation occurring to the Gg3 subunit. In contrast to other cell
lines, CHO cells are amenable to several gene amplification techniques and have a well
characterized genome (Tingfeng et al., 2013).
Despite being a common method for measuring gene expression, our experimental
design was limited by the basic premise of RT-PCR. Considering RT-PCR is based on

50

the ability of sequence-specific primers binding to mRNA transcripts before its
translation into a protein, it is possible that Gng3 or Cnr1 was rapidly translated into a
protein and thus not detected in our reaction. However, this would be unlikely
considering that Gng10 was detected in the reaction and undergoes similar posttranslational modifications as Gng3. Considering that Cnr1 is intronless and therefore has
one less major RNA processing event to skip over (Onaivi et al.,, 1999), this may have
been more likely in Cnr1.
While it is theoretically possible that the Gng3 and Cnr1 transcript underwent rapid
translation and was therefore not detected using RT-PCR, it is extremely unlikely
considering the high sensitivity of RT-PCR (Wong and Medrano 2018). This could have
been reconciled by assaying for protein levels in parallel to our RT-PCR analysis.
Additionally, it is possible that using only a single cell line may have interfered with us
gathering more biologically relevant data. Future researchers may benefit from using both
continuous and primary cell lines derived from populations of cells from humans or other
organisms that they are interested in studying.
2. Concentration and Purity of DNA for Transfection

Establishing an expression system suitable for assaying was an imperative step in our
measurement of cAMP and intracellular calcium (discussed below). We established
transient expression models of Cb1 and Gng3 in CHO-K1 cells via the electroporation of
plasmids encoding our genes of interest. Plasmids were obtained through the cDNA
Resource Center. We ensured all plasmids were at a A260/A280 between 1.7-1.9 prior to
transfection. Transfection efficiency of at least 80% was validated in each experiment by
co-transfection with a GFP expressing plasmid. GPF was visualized using fluorescent

51

microscopy. To check the identity of these plasmids, we used restriction enzymes that
cut areas spanning our gene of interest. The restriction enzyme digest was
electrophoresed on an agarose gel and the insert was compared to a ladder of known sizes
(Figure 14). Both Cnr1 and Gng3 were cloned separately into pcDNA3.1. The plasmids
encoding Cnr1 were cut with Xhol and EcoR1 to yield expected product lengths of
5427bp and 1419bp. We found bands present at lengths of 5450bp and 1400bp. The
plasmids containing Gng3 were cut with Xhol and HindIII to yield expected products of
5408bp and 250bp. We found bands present at lengths of 5400bp and 250bp. The EGFP
cloned into pdDNA3 was cut with Xmn1 and made cuts at position 2220 and 5601. The
expected product lengths were 3381bp and 2778bp and bands were found at 2800bp and
3350bp. These data suggest that the plasmids used in our transfections contained our gene
of interest. However, we did not conduct immunoblots to confirm expression.
Transient transfections have often been used in studies aimed at evaluating gene
functionality, especially in CHO cells (Muller et al., 2007). While there are a wealth of
tools that allow researchers to heterologously express recombinant proteins, we chose to
use electroporation because of its well validated track record for high-efficiency
transfections (Kim, T. K., and Eberwine, J. H. 2010) . By co-transfecting GFP, we were
able to visually confirm the delivery of the plasmid, a common method in cell
transfection studies (Chicaybam et al.,2017).
While transient transfections certainly have their use in pharmacological perturbation
studies, they do not come without limitations. Transient transfections typically result in
the expression of proteins at levels well above those in normal, physiological conditions
(Blasi et al., 2021). We initially observed poor confluency of our CHO cells following

52

electroporation of our plasmids. Moreover, the CHO cells appeared unhealthy when
visually inspected. Despite having an A260/A280 between 1.7-1.9 which indicated a
relatively pure sample of plasmid DNA (pDNA), we attributed the poor growth to
possible contamination from the E.coli used to amplify our plasmids. This was reconciled
using an ethanol precipitation of our pDNA prior to electroporation. Precipitation of
pDNA has been shown to increase transfection efficiency and reduce contamination
Irwin and Gutmann (1997) . It should also be noted that that the precipitation also
allowed us to achieve a pDNA concentration of ~500 ng/µl (as recommended by
manufactured), which improved transfection efficiency and allowed better growth of the
cells.
It is important that future researchers using E.coli as a host for cloning take extra
precautions to eliminate contamination prior to transfection. We found that using an
ethanol precipitation of our pDNA increased transfection efficiency and optimized for
better cell growth after electroporation. Moreover, researchers should consider
establishing a stable expression cell line that is more representative in terms of gene
expression to those in physiological condition. This should include measuring protein
levels and comparing it to in-vitro levels of expression.
3. Validation of the cAMP-GLO Assay
An important component for in vivo functional characterization of cannabinoid
receptors is the ability to measure cAMP levels. We chose to utilize an indirect reporterbased method of cAMP quantification using the cAMP-GLO assay. Intracellular cAMP
activates PKA which modulates the amount of ATP in the assay. The ATP levels are

53

coupled to a luciferase reaction and are quantified by the change in Relative Light Units
(RLU’s) emitted from the sample (DeltaRLUs). Using known concentrations of cAMP in
black, 96-well plates, we were able to generate a linear correlation at cAMP
concentrations from 0-0.125uM.
There are several methods to functionally characterize GPCRs in terms of cAMP
quantification. While the standard method of quantitating adenylyl cyclase activity it to
measure the conversion of [a-32P]ATP to [32P]cAMP, this method requires specialized
equipment and approvals to work with radiolabeled atoms (Salomon et al., 1974, Zheng
and Xien 2012). Nevertheless, PKA-dependent reporter assays have been shown to be a
reliable method in studies using CHO cells (Kumar et al.,2007, Goueli and Hsaio) and are
safer than radiolabeling studies. Utilization of the black 96-well plates was prompted due
to the current availability of supplies at the time our research had occurred. While the
manufactures recommended using white 96-well plates, supplies were extremely limited
due to the COVID-19 pandemic (Woolsten, 2021). We had also measured standard
cAMP concentrations in both V-bottom and clear plates with little success (data not
shown). Luminescence from neighboring wells had interfered with our readings and
prevented accurate measurement.
Validation of this assay proved to be a major hurdle in our experiments. While black
plates yielded the most accurate data of our standard, it created inherent complication in
the visual confirmation of the number of cells present in each well. We reconciled this by
plating the cells in clear plates in parallel to the black plates. The number of cells in clear
plates were counted and verified before assaying. While this helped control for the
number of cells in each well, it did not correct for the limitations that are associated with

54

reporter assays (Kain and Ganguly 2001) including their high sensitivity to any cell
stress. Several experiments have shown that reporter assays are extremely amenable to
many types of interference (Neefjes et al.,2021) and that the data generated can be highly
variable amongst similar studies (Niedermnerg et al.,2003).
While Delta RLU’s in our standard curves that were used to validate our equipment
remained relatively constant, the majority of our issues presented when using lysed CHO
cells. Despite our assaying system being sensitive to DeltaRLUs corresponding to cAMP
concentrations in the low micromolar range (0-0.125uM), high luminescent signals
present at random in the wells of untreated lysed CHO cells complicated our analyses.
We initially attributed this to defective Protein Kinase A (PKA) from the manufacturer.
This was reconciled by using new PKA from separate lot numbers (kindly provided by
Promega Corp). While this did provide us with more consistent results, we still had
encountered problems with high variability in luminescent signals when measuring
cAMP in lysed CHO cells not receiving a treatment.
Ultimately, we attributed the ranging levels of DeltaRLUs to the presence of high
amounts of ATP in our cells. Considering that the ATP concentration in cells are
influenced by many factors and that CHO cells are glycolytically active and thus have a
high rate of ATP turnover (Zhang et al., 2021), any small changed in the initial culture
conditions can dramatically alter the levels of intracellular ATP. This in turn can amplify
the signals detected in each trial due to the mechanism of the luciferase assay. In
retrospect, it would have been beneficial to serum starve the cells prior to assaying. This
would significantly eliminate the amount of ATP that would interfere with the luciferase
reaction.

55

If possible, future research should focus on quantifying cAMP by using methods
that yield results that are more reproducible, like radioactive tracer assays. In instances
where this equipment is not readily available, researchers should consider the mechanism
used to detect cAMP in their assay to be sure that other protocols in their experiment (like
methods of cell culturing or treatment times) will not interfere with the data that they
obtained.
4. Forskolin-stimulated cAMP accumulation in CHO-K1 cells expressing gng3 and
Cb1
The data presented in this study suggest that although cAMP accumulation is not
significantly changed upon Gg3 forced expression, an obvious trend exists between cells
transfected with a plasmid for Cnr1 or with plasmids for Cnr1 and Gng3 and treated with
anandamide. CHO-K1 cells expressing only the Cb1 receptor and treated with AEA
trended toward decreasing cAMP accumulation when compared to basal levels of cAMP.
However, when expressing Cb1 and Gg3 and treated with AEA, cAMP accumulation
increases above basal levels. These data suggest that the presence of Gg3 in Cb1
expressing CHO cells can change the cell from inhibiting AC-mediated cAMP
accumulation to activating AC. Nevertheless, the lack of statistical significance and the
high variation between trials lead us to reject our hypothesis that preferential coupling of
the Gg3 subunit to the Cb1 receptor is responsible for increasing cAMP accumulation.
While our data lacks statistical significance in the differences in cAMP accumulation
when CHO cells are co-transfected with Gng3 and treated with AEA, it highlights an
observation that has been reported on by several other independent researchers—
pleiotropy of the Cb1 receptor. While activation of the Cb1 receptor predominately

56

couples to Gi proteins, several observations highlight the heterogeneity of this system and
have led to speculations that the Cb1 receptor is promiscuous. Our experimental design
logic was to determine whether the ‘forced’ coupling of Gg3 to Cb1 would have an effect
on cAMP accumulation. We proposed that co-transfecting Cnr1 and Gng3 in cells that do
not endogenously express these proteins would allow the Gg3 subunit to be the primary gsubunit in the G protein heterotrimer. Moreover, in cells only expressing Cb1, the
heterotrimer would consist of Ga,Gb and Gg subunits that are endogenously expressed in
CHO-K1 cells. Stimulation of Cb1 with its endogenous agonist AEA and measurement of
cAMP would unveil a response that was mediated by either the inhibition or activation of
AC. We thought that if we forced Gg3 to be the primary g subunit that associated with the
receptor complex, then we would observe a ‘switch’ in responses. In other words, cells
treated with AEA and expressing only Cb1 would decrease cAMP whereas cells
expressing Cb1 and gng3 would increase cAMP. However, our experimental results
proved to be more complicated as we experienced large ranges of DeltaRLU’s and often
only subtle differences in the levels of cAMP.
Despite this being the first study (to the best of our knowledge) looking at the role of
the g subunit on activation or inhibition of AC (as measured by cAMP accumulation) for
the Cb1 receptor, it is not the first study to identify Cb1s ability to ‘switch’ from
decreasing to increasing cAMP. One study identified this switch in a subset of neurons in
the globus pallidus of rodents (caballero et al.,2016). What started as an observation that
cannabinoid treatment would sometimes enhance synaptic transmission in these
dopaminergic neurons, Caballero et al. (2016) showed that blockade of Gi proteins by
PTX treatment resulted in the increase of cAMP (mediated by Gs). Earlier evidence for a

57

Gs linkage to the Cb1 receptor occurred in 1997 when Glass and Felder demonstrated
that concurrent stimulation of D2 receptors and Cb1 receptors in striatal neurons inhibited
cAMP accumulation but when treated with PTX, cAMP accumulation increased.
Furthermore, they showed that this response was mediated solely by the Cb1 receptor and
occurred in a concentration-dependent manner that was blocked by Cb1 antagonist.
Interestingly, these results were reproducible using CHO cells only expressing the Cb1
receptor (Glass and felder, 1997). The researchers in these aforementioned studies
speculated that G proteins were being sequestered by a common pool of readily available
G proteins, and that blockade of Gi via PTX unmasked the stimulatory properties of Cb1.
In our study, it is possible that a large common pool of readily available G proteins
are present in the cytoplasm. Considering we only experimented using a single GPCR
and did not use toxins to disrupt the coupling of Gi proteins, g3 may not have been able to
out compete other g subunits from being associated to the heterotrimer. In other words,
Cb1 receptors can still interact with heterotrimeric G protein complexes that are formed
without the g3 subunit. Moreover, by using only one GPCR, the Cb1 receptors could still
interact with other heterotrimeric G protein combinations that contain an inhibitory α
subunit and another g subunit. This in turn means that the inhibitory actions of the
heterotrimeric complex would be competing with the stimulatory actions of the
heterotrimeric G protein complex with g3 that we proposed, and its contribution was only
minimal to the overall levels of cAMP. Perhaps a more appropriate experimental design
would have incorporated simultaneous transfections with other GPCRs that could deplete
the common pool of inhibitory G proteins, therefore allowing the stimulatory actions of
Cb1 coupling to g3 to prevail. Similarly, we could have also treated the cells with PTX to

58

eliminate the inhibitory properties of the Gαi subunits. While these experiments may
reconcile the possibility of Cb1 coupling to other net- inhibitory heterotrimeric
combinations , we speculated that g3 would be more abundant considering that transient
transfections typically result in proteins being expressed at levels above those under
endogenous conditions (tubio et al., 2010).
In support to the claim that the inhibitory actions of Gai were significantly greater
than the stimulatory properties of Gg3, research conducted by (Saroz et al.,2019)
demonstrated that stimulation of AC by Gbg in CB2 expressing cells occurred first,
causing an initial increase in cAMP. This was then followed by a decrease in cAMP
mediated by the Gbg dimer. This may suggest that inhibition and stimulation of AC may
be occurring simultaneously through the actions of different AC isoforms (Saroz et
al.,2019) which may result in an initial inhibition of AC through the actions of GaI. In the
context of our experimental design, cAMP was only measured after the cells were
stimulated with either FSK or AEA after 10 minutes. This would mean that our studies
were limited to cAMP levels present at a specific time point thus, preventing us from
observing the different phases in increasing levels of cAMP followed by decreasing
levels of cAMP. In hindsight, a more appropriate experimental design would have been
to incorporate treatments with agonists at several timepoints before measuring cAMP
accumulation.
The lack of significance in cAMP accumulation along with the large range of data
obtained from our experiments of the same treatment group but in different trials
ultimately lead me to conclude that the presence of Gg3 does not alter cAMP
accumulation. However, it may be beneficial for future studies to first identify the

59

“primary” g subunit used in GPCR signaling and subsequently knocking out that subunit
before experimenting. This will prevent the possibility of the canonical GPCR
heterotrimer from being associated to the Cb1 GPCR complex. Moreover, an initial
investigation onto what AC isoforms is present, and their selective responses to various g
proteins could prove useful in any future experiments looking at G protein signal
transduction.
5. Intracellular Calcium in AEA stimulated CHO-K1 cells expressing gng3 and
Cb1
Our experiments involving the measurement of intracellular calcium transits in CHO
cells transfected with Cb1 or Cb1+GFP demonstrate that AEA does not evoke the release
of intracellular calcium transits from the ER. While we had originally hypothesized that
the forced coupling of gng3 to the heterotrimeric pair of G proteins that would associate
with Cb1 would result in the ‘switch’ of a Gs like response to a Gq like response, our
data fails to corroborate our hypothesis. Similar to the experimental model we used to
evaluate a Gs-like response in our cAMP assay, we sought to determine whether forced
expression of gng3 could evoke a Gq like response. Several attempts to measure the
release of intracellular calcium in cells expressing Cb1+GFP or Cb1+gng3 were made
using AEA concentrations of 10uM and 100uM. In all trials, AEA application had no
effect on intracellular calcium.
Our data is in line with other studies that show Cb1 does not evoke increases in
intracellular calcium (Howlett et al., 1987; Howlett et al., 2002). However, other studies
using varying cell types refute these findings. For instance, (Hegyi et al.,2018) and
Navarrete and araque (2008) demonstrated that application of the Cb1 receptor agonists

60

induced a Gq-like response by increasing levels of intracellular calcium. In an elegant
experimental design using primary rat astrocytes, Hegyi et al. (2018) showed that
application of Cb1 receptor agonists (10 uM anandamide, 2-AG, and WIN) induced the
release of intracellular calcium. These researchers also showed that AEA evoked the
strongest calcium response when compared to 2-AG and WIN. This response was absent
in Cb1 knock out mice, indicating that the response is occurring through activation of the
Cb1 receptor. Moreover, this response was blocked by pretreatment of cells with AM251
(a Cb1-specific antagonist). Although we failed to observe an increase in intracellular
calcium evoked by stimulation of AEA, differences in our experimental design may be at
fault. Our experiment used AEA to stimulate CHO cells expressing Cb1, while the
aforementioned studies used primary astrocyte cell lines. Considering astrocytes are
found in the CNS and directly involved in processes mediating neuronal excitability, it is
reasonable to assume that these processes would be unlikely to occur in CHO cells (an
epithelial-derived cell line). Moreover, these researchers observed differences that were
dependent on the Cb1-specific agonist that were used. While all studies did observe
calcium increases in response to AEA, it is possible that using a different Cb1 agonist
may have evoked increases in intracellular calcium.
On the basis of the specific cellular context being pertinent to the response, several
studies suggest that Cb1 can act synergistically with other GPCRs, which alters its ability
to stimulate G protein pathways. This was demonstrated by Moreno et al.,(2017) who
conducted experiments showing that Cb1 is co-expressed in various subpopulations of
neurons in the brain (i.e. cortical GABAergic interneurons or Glutamatergic neurons).
These studies suggested that Cb1 may act as a G-protein ‘sink’ by sequestering the

61

readily available G-proteins and thus making them unavailable for other receptors.
Similar conclusions were also reached by Vasquez and Lewis (1999) using superior
Cervical Ganglion (SCG) cells in rats. In the context of our experimental design, Cb1
would not be expressed at the correct stoichiometric proportions with other receptors that
are present in neurons under normal physiological conditions. The most notable
differences between these studies and ours is their use of primary cell lines compared to
our use of CHO-K1 cells.
Another possibility that can partially reconcile the apparent Gq-like response evoked
by Cb1 stimulation could be that the response does not occur through the actions of the
Gq pathway. Offering support to this hypothesis, Daniel et al.,2004 revealed that
application of WIN onto parallel fibers of the rat cerebellum inhibited presynaptic
calcium transits. This effect persisted when cells were pre-treated with toxins that prevent
the activation of Gi/o, N, P/Q and R type Ca2+ channels (PTX, ω-agatoxin TK, ωconotoxin GVIA, SNX-482, respectively). The response was not blocked when treated
with tertiapin-Q, a toxin specific to G protein-gated inwardly rectifying K+ channels
(GIRKs)—suggesting the actions are mediated by GIRKs. An important difference to
note is that our experimental model was unable to determine whether AEA would inhibit
calcium transit considering a Ca2+ -free buffering solution was used to prevent
interference with the Fura-2AM fluorophores.
Arguing against a Gq independent mechanism came later in 2005 when Lauckner
et al.,2005 demonstrated that HEK-293 and cultured hippocampal neurons increased
intracellular [Ca2+] only when treated with the Cb1 receptor agonist WIN. The response
was abolished when pretreated with the Cb1 antagonist SR141716A and acted

62

independently of Gi/o proteins as the response persisted and was enhanced when treated
with PTX. It is important to note that this response was WIN Specific and did not occur
in cells treated with THC, HU-210, CP55, 2-AG, Methandamide and CBD. Researchers
concluded that this response was mediated through the actions of Gq proteins and
Phospholipase C (PLC) considering the response was attenuated in cells expressing
dominant negative Gq, or when treated with PLC inhibitors. Moreover, this response was
blocked by the sarcoplasmic/endoplasmic reticulum Ca2+ pump inhibitors. Considering
we were unable to generate any sort of intracellular calcium response mediated by AEA
stimulation, the use of these inhibitors would not have been beneficial in the context of
our experiment.
While there has been a plethora of studies aimed at identifying the specific response
mediated by activating Cb1, key differences in experimental design (e.g. cell type, ligand,
and experiments conducted in vivo or in vitro) make it challenging to elucidate the
underlying mechanisms involved in Cb1 receptor transduction. While these differences
are unlikely an intrinsic property unique to the Cb1 receptor, it certainly highlights
emerging properties of GPCR’s role in signaling through multiple pathways.
6. Validation of a Visual Motor Response (VMR) Paradigm in Zebrafish Larvae
Prior to generating mutant zebrafish, we wanted to validate a behavioral paradigm
sensitive enough to detect subtle differences between our mutants and the wild-type
phenotypes. We planned to characterize the phenotypes of the mutants with and without
the treatment of AEA. The differences between wild-type and mutant phenotypes would
be attributed to the mutation, whereas the differences between the phenotype of untreated
versus treated mutants would be attributed to the absence of g3 coupling to the Cb1

63

receptor. To be sure that our injections did not have an effect on zebrafish behavior that
would be reflected in our data and later attributed to the mutation, we operated off the
hypothesis that zebrafish injected with GFP would have a similar VMR when compared
to wild type. Our data showed that on average, both WT and GFP mutant zebrafish
juveniles travelled \ significantly less in phase 3 (high-intensity light) than those in phase
2 (low-intensity lighting). There are no significant differences between the average
distances travelled by GFP mutants in phase 1 or 2. Since we did not calculate the
distance travelled in phase 2 of our WT group, we are thereby unable to accept or reject
our hypothesis that our injections do not have effect on VMR.
Although unable to accept or reject our hypothesis regarding the VMR in GFP
compared to WT, our analysis showed that in both phase 1 and phase 3 of our
experiments, there are no significant differences in distance traveled between WT and
GFP mutants. Therefore, it is reasonable to assume that microinjection itself did not
dramatically effect locomotion. Our data is in partial agreement with other similar VMRs
conducted using juvenile zebrafish. The relatively large standard errors within groups
were attributed to the individual biological variation that is inevitable when using live
model organisms (see below). While the obvious outliers may have been omitted from
the dataset for ease of determining significant differences, this would have been
subjectively determined and would therefore interfere with the integrity of the dataset.
Therefore, this variation was a significant factor in determining the significance between
groups and may have been reconciled using a larger sample size.
Using a similar experimental design, Emran et al.,(2008), demonstrated that on
average, zebrafish have distinct responses to sudden changes in light intensity. Zebrafish

64

larvae (4dpf) increased their activity more than double following the transition from high
intensity lighting to dark. When the lights are turned back on, activity levels return to
basal within a short period of time (~30 seconds). This is in partial agreement with our
data showing an increase in activity in the dark phase of GFP mutants followed by
activity levels dropping below that of those in dark phase. Several important differences
between our study and the study conducted by Emran et al. (2008) may be responsible for
the relatively modest increase in activity under dark conditions when compared to those
observed by Emran et al.,(2008). For one, our sample size was much smaller which may
have prevented our analysis from capturing these dramatic differences in activity.
Additionally, Emran et al.,(2008) used fish at 4dpf whereas we utilized fish at 7dpf.
When considering the rapid maturation of the zebrafish nervous system in the early
stages of development, it is not surprising that the overall movement in zebrafish larvae
may be more dramatic compared to those in later stages of development.
Research conducted by Burgess and Granto, (2007) using WT zebrafish found that
reduction in illumination resulted in a period of transient hyperactivity. Burgess and
Granto (2007) found that the increase in activity was characterized by large angle turns
that persisted for a period of 5 minutes following reduction in illumination. In
comparison to our experimental design, the total distance during the whole period lights
on or off was the only parameter measured. We did not characterize the movements or
turns in our study, so we are unable to attribute the hyperactivity to any specific types of
movement. In hindsight, it would have been beneficial for us to not only measure the
distance travelled, but to also characterize specific movement patterns and bending.

65

Similarly, Ganzen et al. (2021) showed a dramatic increase in distance traveled
during the dark phase. Although, the increase was only present for a short period of time
(~5 seconds) after the transition from light to dark. While Burgess and Granto (2007) and
Emran et al. (2008) also reported transient hyperactivity under low illumination, the
effect persisted for about 5 minutes and 30 seconds, respectively. Yet again, the duration
of hyperactivity between these studies refutes each other. More recently, in what appears
to be the most well-controlled VMR study, researchers elegantly demonstrated a linear
relationship between the cumulative distance travelled and light intensity between 2kLux
and 10kLux, suggesting that stimulus intensity is a direct function of light intensity.
These data may explain discrepancies among other studies of similar experimental design
(Beppi et al., 2021).
Adding more complexity to the existing data on the VMR response in zebrafish,
Tuz-sasik et al.,(2022) conducted a series of experiments to evaluate how different
experimental illumination settings effected locomotor behavior. In all experiments,
zebrafish juveniles were more active under light conditions when compared to dark
conditions. While this data refutes data obtained from our study showing that GFP
injected juveniles were most active under low light conditions, the researchers only
compared locomotion between two conditions, Light and Dark. Our paradigm utilized a
Light-Dark-Light set up which revealed that fish were initially more active under high
illumination in phase 1 when compared to Phase 3. Importantly, Tuz-sasik et al.,(2022)
found that the activity under light was greater when light was presented last compared to
when light was presented first. Researchers attributed this phenomenon to acclimation or
habituation of the environment. In the context of our data, it is possible that in our study,

66

the fish expended higher amounts of energy when activity levels were relatively greater
during phases 1 and 2. Moreover, our fish were under high intensity lighting prior to
acclimating to the light box where their arenas were housed. This change from highintensity overhead lighting to high-intensity (but more direct) lighting in the arena may of
induced an anxiety-like response during their acclimation, thus partially explaining the
relatively higher levels of activity in phase 1 compared to phase 3. Nevertheless, the
dramatic differences observed in activity that were dependent upon the order of either
light-dark or dark-light make it difficult when comparing the results of our study.
Many of these studies differ from ours in several ways including the software used to
measure movement, specific behavioral endpoints of interest, duration of light/dark
exposure, acclimation periods and the arenas used in assaying. These slight differences in
experimental design have minute—yet summative effects on the results obtained and
illustrate the complexity of how neurobehavioral paradigms make it difficult to
extrapolate biologically relevant findings. Moreover, linking simple changes in
locomotion to a specific molecular event is certainly not straight forward and should be
recognized as an important limitation to the VMR assay.
It Is important to mention several factors that complicated our analysis and that we
hope may be of good use for future researchers interested in utilizing a similar
experimental paradigm. For instance, ImageJ had difficulty tracking the movement of the
juveniles under Low-light conditions. Even after manually adjusting the threshold for
individual wells, the software was unable to identify the subtle differences between the
juvenile’s zebrafish and the white background that the fish were in. Moreover, the abrupt
change in light intensity bleached out the frames following phase 1 and phase 2. This

67

prevented us from identifying the individuals that startled with a “C or O” like bend and
from measuring the initial response (distance travelled) following a change in light
intensity. While this may be an inherent problem associated with filming under low-light
conditions, some simple remedies may offer a solution. Future researchers may be able to
utilize two cameras that are situated above the arena. With one camera being adjusted to
low light intensity, and the other to high light intensity, the frames could be extracted and
matched to the appropriate phase. Another possibility would be to adjust the exposure to
a setting that would accurately capture the response in both low and high intensity
lighting. This would require a researcher to carefully monitor and appropriately adjust the
exposure and light intensity to a level that can be accurately captured, while still eliciting
the same light/dark response.
Another issue was the depth of the wells, which would inevitably “hide” the zebrafish
when they would around the edges. This made it impossible to track the location of the
juveniles when they would leave the field of view. Our initial resolution was to lower the
amount of water used in each well which would limit movement of fish in the vertical
plane, thereby preventing them from moving into the blind spot. However, the amount of
water would severely limit their movement and would have made it difficult for future
studies where a defined amount of water was needed for treatment with AEA. Perhaps a
better solution to this would have been to use the same wells that was utilized in the
auditory response trials. Nevertheless, we recommend researchers perform several trials
at different camera angles and/or arenas to determine how to best remedy this issue.
7. Validation of an Acoustic Startle Paradigm in Zebrafish Larvae

68

In addition to the VMR, we wanted to validate an assay that could be used to
characterize mutant zebrafish. In anticipation to the generation of our mutants lacking the
g3 subunit, we tested weather AEA treatment (10uM) would have an effect on the
acoustic startle response. We hypothesized that WT juveniles treated with 10uM AEA
would have a significantly delayed startle latency and would travel less compared to the
untreated control. Our results showed no significant differences between the total
distance travelled or the startle latency between treated and untreated juveniles.
Moreover, the results obtained in our duplicate trials did not differ significantly from
each other. Our results lead us to conclude that AEA has no effect on the acoustically
evoked startle response in zebrafish juveniles at 7dpf.
To the best of our knowledge, this is the first study to look at the startle response
in zebrafish exposed to AEA. However, one major limitation in our research is the lack of
a positive control— a test compound known to affect the startle response that would have
demonstrated that our assaying system was capable of measuring these differences. Our
experiments were performed in duplicate using several fish receiving treatment with
AEA and no treatment. While we were sure to include equal amounts of fish of both the
treatment and control group in each trial, our experiments were performed in duplicate,
thus presenting another inherent limitation. Although an analysis between both trials
showed no significant differences were present, suggesting that our experimental setup is
unlikely to have significant effect on the any differences that would have been observed
from our trials. Our results suggest that Anandamide treatment has no effect startle
latency or mean distance traveled in zebrafish, though we are cautious when making this
interpretation because of these mentioned limitations.

69

Using a novel method where activity levels are quantified using horizontal and
vertical line breaks, Smith et al., (2021) demonstrated that AEA treatment has a dose
dependent effect that significantly increases physical activity in adult zebrafish. While
this study differs from ours by both the paradigm used to measure activity and the age of
zebrafish, they reasoned that expression of Cb1 in the basal ganglia and cerebellum may
be responsible for the increase in physical activity. Additionally, they observed that fish
in the treatment group were less likely to spend time around the edges and bottom of the
arena, suggesting that the treatment may have anxiolytic properties. While it may be
tempting to attribute the differences in activity levels in our study compared to the ones
obtained by Smith et al., (2021) to a lack a fully developed endocannabinoid system in
juveniles, this is unlikely. Oltarbella et al.,(2017) showed that many of the genes that
makeup the endocannabinoid system in zebrafish were stably transcribed at 48hpf.
Moreover, Migliarini and Carnevali (2009) showed that treatment with the synthetic
cannabinoid AM251 dramtically decreased activity levels of in zebrafish larvae as early
as 96 hpf. One possibility that may partially explain why no changes in activity were
observed in our study, despite the clear support for the endocannabinoid systems
involvement in activity found in other studies is the time spent treating and measuring
activity in the zebrafish. Smith et al., (2021) treated fish for 30 minutes and Migliarini
and Carneveali (2009) chronically exposed larvae to the agonist throughout its
development to 96hpf. Moreover, both studies were interested in the how the treatment
effected overall activity levels in the fish. Our study is limited in this area considering our
treatments with AEA were only for 10 minutes and the overall activity levels were not

70

measured. In hindsight, a longer treatment followed by recording basal activity levels
before the startle would have been beneficial.
Perhaps another explanation to these differences observed in our studies come
from the fundamental mechanism that generates the startle response. The M-cell circuit
responsible for eliciting the auditory startle response in zebrafish is mediated by sensory
neurons that synapse M-cells responsible for the activation of descending reticulospinal
neurons (Xu et al., 2021). We reasoned that because Cb1 receptors are found on
reticulospinal neurons in zebrafish (Watson et al., 2008) and an inherent function of these
receptors are to inhibit presynaptic neurotransmission, it is likely that activation of these
receptors would perturb the ability of these neurons to produce an action potential.
Moreover, we reasoned that the effects would be evident in any stimulus that activates
this M-cell circuit. However, recent data published during our experimentation by Beppi
et al., (2021) showed that the distance travelled during an acoustically evoked auditory
startle response was significantly higher when the stimulus was 126 dB compared to all
other lower intensity stimuli. This finding corroborates the claim that the intensity of the
stimulus has direct effects on the M-cell mediated response and means that the intensity
of the stimulus used in our experiment (120dB) likely “overpowered” the inhibition
caused by Cb1.
In a series of elegantly designed experiments aimed at functionally characterizing the
cannabinoid receptors function in relation to locomotor behavior in zebrafish larvae,
Lutchenburg et al., (2019) found that treatment with the exogenous cannabinoid receptor
agonists WIN55,212-2 and CP55,940 decreased locomotion in larvae at 5dpf. This was
observed in both basal, and startle-induced locomotion. Moreover, these effects were

71

mediated by the Cb1 receptor considering the effects were abolished in mutant Cb1 -/fish. Importantly, Lutchenburg et al., (2019) speculated that endocannabinoids at this
level of development are not active in regulating locomotion considering that use of the
Cannabinoid receptor antagonist AM251 alone has no effect on regulating locomotion.
While this certainly corroborates our findings showing no differences when the
endocannabinoid AEA was administered, it poses an interesting question— Why do
zebrafish possess all relevant components of the endocannabinoid system in the areas
known to regulate locomotor activity at this stage of development if they serve no
biological purpose in locomotor behavior? This question is especially relevant when
considering their findings that activation of the Cb1 receptor effects locomotor activity in
zebrafish. It is likely that considering many of the endocannabinoids are produced ondemand (Krug et al., 2015), there were no receptor-bound endocannabinoids available for
the antagonists to act on. Nevertheless and in the context of our experiment, the use of
synthetic agonists by Lutchenburg et al., (2019) and our use of the endocannabinoid AEA
may of likely contributed to the differences in behavior observed.
Treatment with several different compounds have been known to modulate acoustic
startle responses in developing zebrafish. . For instance, treatment with amorphine was
shown to reduce the startle latency. Whereas pretreatment with the D2 receptor
antagonist haloperidol enhanced the startle latency. Moreover, Haloperidol was able to
attenuate the amorphine induced reduction to startle latency (Burgess and Granato, 2007).
Another study conducted by Pantoja et al.,(2016) also showed that amorphine
significantly increased the total distance traveled after startle in zebrafish. Interestingly,
these researchers also demonstrated that pre-treatment with the serotonergic agonist

72

quipazine alone had no effect on startle, but could also attenuate the startle response of
amorphine treated zebrafish (pantoja et al., 2016). These studies demonstrate a significant
dose-dependent effect on movement in zebrafish treated with the varying
pharmacological agents. This contrasts with our experimental design which only used a
single concentration of anandamide (10uM). In hindsight, it would have been beneficial
to use multiple concentrations of Anandamide that would allow us to determine if dose
had any effect on movements. Moreover, considering the multiple levels of cross-talk
occurring between receptors of the endocannabinoid system and the receptors of other
systems (i.e. dopaminergic, serotonergic, etc)(Chiang and Chen 2013, Colangeli et al.,
2021), co-treatment of AEA with drugs acting on these systems may of revealed novel
endocannabinergic interactions that regulate locomotor behavior in zebrafish.
M-cell mediated responses have a shorter onset (<12 ms) when compared to non-M
cell mediated responses (~28 ms) that also increase swimming velocity (Roberts et
al.,2011). Due to the frame-rate of the camera used in our experimental design, we could
only use the presence or absence of a C-bend to validate the response as M-cell Mediated.
While a C-bend was observed in all subjects where an increase in swimming velocity of 2
standard deviations above the mean swimming velocity were present, future research
using a higher frame-rate camera may find it useful in characterizing responses that are
not mediated by the M-cell circuit.

8. Design of CRISPR guide RNA
Several factors must be considered when designing a guide RNA that will deliver the
cas9 endonuclease to the coding region of the proposed gene of interest. These factors

73

include finding an area of the genome that contains the proper Protospacer-adjacent
motifs (PAM) sequence that corresponds to the cas9 being used, assuring that the
sequence in this area is not found in other sections of the genome, and that there are
enough 5’ and 3’ flanking nucleotides for designing the appropriate primers (Sorien, et
al.,2018). Considering that the Gng3 transcript is relatively small (232bp) and separated
into 3 exons, 2 of which are coding, we chose to target the largest coding exon, (Exon 3,
second coding exon) in the zebrafish genome using the UCSC Genome Browser. This
sequence was then entered into IDTs genome editing tool and the sgRNA containing the
highest on-target and lowest off-target score were chose for our experiment. As will be
discussed below in the following sections, this method proved useful in our experiments.
Next, we will discuss the methods used in other gene-targeting experiments involving
CRISPR/Cas9 in the zebrafish genome, and how they compare to ours.
The identification of genomic sequencing suitable for CRISPR targeting would be a
daunting task without the use of open-source biotechnology programs. While the details
and configurations of these programs are outside the scope of this discussion, these
programs can sort through large sets of genomic data and identify relevant PAM sites
required for the Cas9 nuclease to cut. The relevant target sites are then compared to
sequences within the entire genome to allow researchers to pick the sequence that has the
lowest probability of generating off-targets Indels.
The work presented by Varshney et al., (2015) uploaded the entire zebrafish genome
into a program called Bowtie (first described by Langmead et al., 2009) to identify PAMs
that were used to design their guides. Similar to our design using IDT’s genome editing
tool, Varshney et al., (2015) used bowtie to identify target regions with the lowest off-

74

target score to avoid generating off-target mutations. This method of sgRNA design
allowed them to generate high-efficiency mutations (as discussed below). One drawback
to their sgRNA design method was the presence of 5’ mismatched nucleotides, which
was reported to have a significant effect on its targeting efficiency. While one of their
objectives was to evaluate the high-throughput efficacy of bowtie in designing sgRNA
used for gene targeting, it highlighted an important factor for future researchers to
consider when designing gRNA. Fortunately, our sgRNA did not contain mismatched
bases in the 5’ or 3’ end, as these sets were omitted by IDT. However, due to slight
genetic variation among individuals and the possibility of Single Nucleotide
Polymorphisms (SNP), it may have been beneficial for us to ensure that we were not
targeting a region of the exon known to harbor SNPs, especially near the 5’ end.
Similar to the open source programs from IDT and Bowtie, Brocal et al.,(2016) used
a program originally designed for use in mouse and human genomes to generate sgRNA
(see review by Doench et al., (2016) for review on the CRISPR package). These
researchers sought to develop a highly efficient pipeline method of generating and
evaluating zebrafish CRISPANTs. Brocal et al., (2016) method relied on the in vitro
transcription of the sgRNA which required additional steps to insert the T7 promoter
sequence, followed by the guide RNA sequence and the overlap sequence. Our method
precludes these additional steps as we utilized IDT to synthesize the crRNA which was
assembled to the tracrRNA (which constitutes the sgRNA) immediately prior to
injections.
Considering that many of the open-source programs are available for sgRNA design
are similar in that they use an organisms genetic code to search for unique areas that are

75

amenable to the cas9 technology, it is often based on researchers preference on what
programs are utilized. Still, it is important that researchers have a general understanding
of how these programs are designing the guides and what “rules” they are using in their
determinations. This will allow researchers to use discretion when choosing the
appropriate sgRNA design by taking into consideration other factors, like the size of the
gene and ability to create suitable 5’ and 3’ flanking primers. Moreover, an understanding
of the design logic of the programs used will undoubtedly be beneficial for
troubleshooting. While many of the aforementioned studies relied on methods using
complicated software and programs, we found that our method in designing sgRNA was
simple, user friendly and cost effective. However, it is important to note that these studies
were not only targeting different genes but were interested in designing a high-throughput
pipeline.

9. Microinjection of zebrafish embryos
To successfully target the zebrafish Gng3 gene with our Cas9 endonuclease, we
needed to streamline a system that would allow us to obtain multiple WT embryos almost
immediately after becoming fertilized while simultaneously preparing and loading the
CRISPR components into the microinjector system. We performed several trial runs of
embryo rearing to ensure we could successfully breed, capture, and deliver the embryos
to the microinjector while they were still in the 1-2 stage of development. The sgRNA
was prepared using individual crRNA and tracrRNA components. The RNP complex was
assembled using recombinant Cas9 and sgRNA and loaded into the microinjector
apparatus with 0.08% phenol red for visualization. Prior to the injection of embryos with

76

the Crispr components, several trial injections were conducted where a GFP solution with
0.08% phenol red was used to assure that the injection process would not be a factor in
the developing embryos. Not only did this step serve as a control for the injection
process, but it also gave us practice operating the microinjector and visualizing both
uninjected and injected embryos in parallel during development. Our results support that
the microinjection procedure is safe, and that using recombinant cas9 and chemically
synthesized crRNA and tracrRNA to form the sgRNA and RNP complex can be used in
the microinjection of zebrafish embryos.
Research conducted by Chang et al., (2013) demonstrated the effectiveness of
microinjection of CRISPR-Cas9 in zebrafish embryos. These researchers used a cloningbased method where the RNP complex was assembled in vitro from cas9 and the gRNA
mRNA that was transcribed from a commercial transcription kit. Cas9 (300ng/uL) and
the preassembled gRNA of 20ng/ul into the embryo. Moreover, Chang et al., (2013) used
a luciferase recombination assay as a method to screen the embryos early in development
for successful delivery and uptake of the CRISPR components by the cells. In brief, this
method requires co-injecting a plasmid containing the code for two truncated luciferase
fragments. When a double stranded break (DSB) occurred by the cas9/gRNA, the
luciferase activity could be measured. While this method would certainly be useful as a
means of preliminary screening of F1 mutants, it may result in unwanted side effects
from the plasmid being incorporated into the hosts genome Kim et al., 2018). In
comparison to our microinjection methods, we assembled the RNP ex-vivo using a 2:1
ration of recombinant cas9 to sgRNA (as described by Sorien et al., 2018). Instead of
performing preliminary screening on our mutants using luciferase, we performed mock

77

trials where EGFP was injected into the WT embryos and viewed under fluorescent
microscopy. While it may have been a good control to perform these injections in parallel
to the CRISPR injections, it would have been very difficult considering the time it takes
to load and prepare the microinjector system.
Brocal and colleagues (2016) used methods that were similar to Chang et al., (2013).
In-vitro assembly of the RNP complex was accomplished by annealing target specific
nucleotides containing a T7 promotor sequence to the reverse compliment of the
tracrRNA scaffold. The resulting product was then transcribed using a commercially
available transcription kit and injected into embryos at a ratio of 20:1 Cas9:sgRNA.
While these researchers do not provide any citations or reasoning to this ratio, it is likely
that Brocal et al., (2016) wanted to assure that sufficient amounts of cas9 would be
available for the RNP complex to quickly form. This is, in part, the reason we chose to
assemble to RNP complex ex-vivo (using 2:1 recombinant cas9:sgRNA), as we would
not have to worry about the embryo undergoing further development while the cas9 was
being translated and assembling into the RNP. Moreover, IVT has been shown to cause
innate immune responses in the host immune cells (Mefferd et al., 2015).
Similar methods of in-vitro transcription and purification were used to generate
the sgRNA template and cas9 transcript by Varshney et al., (2015). An important
difference in the experimental design of Varshney et al., (2015) to ours and the other
studies mentioned in this section was the goal of targeting multiple genes in each
injection or using multiple guides targeting the same gene. This required them to use
proportionately more of the cas9 transcript and multiple sgRNAs in their injections
(Varshney et al., 2015). While we initially considered targeting multiple regions of Gng3

78

in our injections, we ultimately decided that the relatively short length of Gng3 may have
been overcome by large Cas9 proteins attempting to find and cut the target sequence.
For embryo rearing prior to injecting, we set up breeding tanks containing 1 adult
male and 1 adult female. The female fish that appeared gravid (swollen abdomens) were
chose and placed in a breeding tank with a male fish chosen at random. Initially, this
method allowed for ~30-40 embryos per tank. However, we noticed large amounts of
variability in the total number of embryos produced which became problematic during
our injections. Nasiadka and Clark (2012) recommended housing male and female fish in
separate tanks until breeding was commenced. We found that after attempting this
method, our embryo yields decreased. While we are unable to state with certainty why
this common practice for embryo rearing was not successful in our lab, we speculated
that the presence of 1 or 2 misidentified males or females in the tank was
counterproductive in our study.
Many of the aforementioned studies detail methods of the in-vivo assembly of the
RNP complex that differ dramatically in terms of concentrations used in the
microinjection procedure. This method is not only time-intensive and costly—as it
requires multiple steps to synthesize, purify and cap the cas9 mRNA, but also depend on
the use of snRNA or tRNA promoters that are constitutively active to drive the in-vivo
production of the RNP (Zhang et al., 2017). Other methods utilize the hosts machinery to
assemble to RNP by cloning the guide RNA into a plasmid vector containing the Cas9
sequence (Chang et al., 2013). While all of these methods operate off of the same
premise—the formation of the RNP by crRNA (containing the sequence complimentary
to the target) and tracrRNA (the scaffold portion that binds to cas9)( (see cui et al., 2018

79

for a review of sgRNA and RNP design tools), they have been shown to result in adverse
side effects, especially when phenotyping the F1 generation. Here, we describe a method
of injecting pre-assembled and solubilized cas9-sgRNA RNP’s. While we cannot
preclude the possibility of off-target mutations generated outside the region amplified by
our primers, it is reasonable to assume that our method is comparable to the in-vivo
assembly considering they do not differ in terms of their fundamental mechanism that
ultimately results in the generation of indels.

10. Analysis of zebrafish gDNA for indel formations
An array of techniques has been employed by researchers to evaluate the functionality
of a protein. These techniques often involve the use of single stranded nucleic acid probes
that bind to and prevent the mRNA transcript from being translated into a functional
protein. The corresponding phenotype is thus presumed to be a result of the defective or
absent protein. While these methods have certainly been successful in elucidating protein
function—they are often time sensitive, costly or limited by large amounts of mRNA that
out-compete the probes. Our research aimed to utilize a method that is not only costeffective but relies on the permanent deletion of the gene early in the development of the
fertilized embryo, thus eliminating the possibility of the DNA template from being
transcribed into an mRNA transcript and subsequent translation of the protein product.
Here we present the successful use of the CRISPR/Cas9 system to effectively target gng3
in zebrafish. Using the methods of gRNA design and microinjections mentioned above,
we were successful at targeting the gng3 gene in developing zebrafish with target

80

efficiency ranging from 12%-95%. Moreover, our study further validates using
heteroduplex banding as an initial method for F0 mutant screening of indels formation.
While we initially set out to characterize the function of the gng3 gene in zebrafish
using the VMR and acoustic stimuli assay, certain factors had prevented this analysis—
an experimental error in trial 1 of our microinjections of CRISPR components when
attempting to extract the gDNA from the embryos of our first round of CRISPR
injections. Additionally, a low yield in embryos produced during our trial 2 of injections
prevented us from collecting a negative control of uninjected embryos that would allow
for a later comparison of survival rates. Although we did perform a mock injection, trial
0, of embryos that were injected with 0.08% phenol red and eGFP and found no
difference in the survival rates of the injected vs uninjected group—suggesting that our
injection procedure and the care for embryos following the injections was safe and not a
factor in mortality but does not preclude the possibility of an any experimental errors that
may be attributed to their deaths (Survival rates in Tables 5-7).

The advent of multiplex sequencing and DNA barcoding has been extensively used to
detect the formation of Indels in CRISPR targeting experiments (Brocal et al., 2014 and
Varshney et al., 2015). In the work presented by Varshney et al., (2015), target efficiency
was calculated using multiplex illumina sequencing data from the PCR products of their
Crispants. The sequence data was then uploaded into a program they developed and
validated called ampliconDIVider
(https://research.nhgri.nih.gov/software/amplicondivider/). For our experiments, target
efficiency was calculated using the Snythego Interference of CRISPR Edits (ICE) tool

81

(for details and validation of this tool, see Hsiau et al., (2019)). While these programs are
both used to quantify the identity and prevalence of genomic edits, the major difference is
that the Synthego ICE tool uses sanger sequencing data as an input whereas the
ampliconDIVider uses sequence data obtained from Next Generation Sequencing (NGS).
We found that the Synthego ICE tool was both user friendly and cost effective by using
the sanger sequence data as an input. Nevertheless, Varshney et al., (2015) reported target
efficiencies between 75-99% whereas our method ascertained a target efficiency of
between 12-93%. An important difference to note is that Varshney et al., (2015) method
utilized several sgRNAs directed toward the same gene in their injections, whereas we
used a single sgRNA targeted that targeted gng3.
In the methods used by Chang et al., (2013), researchers were able to ascertain a target
efficiency of ~35%. After isolating DNA from crispants at 50 hpf, the samples were
subjected to in-house sanger sequencing. Target efficiency was quantified based on
relative band intensity compared to their WT samples. It is important to note that this
research had occurred before the development of many of the bioinformatic tools that
automated this process. While our study does not offer a direct comparison between
Synthego’s ICE tool and the direct visualization of band intensity for generating target
efficiency scores, other studies have provided support that this method is not as accurate
as statistical-based software (Wu et al., 2015 and Germini et al.,2018)
Currently, there are only a handful of well-validated methods used to characterize
InDel formation in the genomic sequences of CRISPR gene-targeting experiments. While
the technical details of these methods vary, they all require researchers to extract and
sequence the genomic DNA from the crispants. The DNA sequences are then compared

82

to those of the WT to obtain relative target efficiency scores that represent the amount of
alleles in the sample harboring an insertion or deletion. Similar to the protocol described
by Sorien et al.,(2018), we used the appearance of heteroduplex bands or a reduction in
homoduplex band intensity to identify possible indel formation in our F0 embryos. The
corresponding PCR products were then sent for sanger sequencing and uploaded into
Synthego’s ICE analysis tool to determine gene targeting efficiency. Despite being
unable to characterize the phenotype of our Crispants, our data demonstrates the utility of
using the heteroduplex band assay as an initial method for screening F0 progeny for
indels and supports the efficacy of our sgRNA design and microinjection techniques.

83

References
Beppi, C., Beringer, G., Straumann, D., & Bögli, S. Y. (2021). Light-stimulus intensity
modulates startle reflex habituation in larval zebrafish. Scientific Reports 2021 11:1,
11(1), 1–7. https://doi.org/10.1038/s41598-021-00535-9
Burger, A., Lindsay, H., Felker, A., Hess, C., Anders, C., Chiavacci, E., Zaugg, J.,
Weber, L. M., Catena, R., Jinek, M., Robinson, M. D., & Mosimann, C. (2016).
Maximizing mutagenesis with solubilized CRISPR-Cas9 ribonucleoprotein
complexes. Development (Cambridge, England), 143(11), 2025–2037.
https://doi.org/10.1242/DEV.134809
Burgess, H. A., & Granato, M. (2007a). Modulation of locomotor activity in larval
zebrafish during light adaptation. The Journal of Experimental Biology, 210(Pt 14),
2526–2539. https://doi.org/10.1242/JEB.003939
Burgess, H. A., & Granato, M. (2007b). Modulation of locomotor activity in larval
zebrafish during light adaptation. The Journal of Experimental Biology, 210(Pt 14),
2526–2539. https://doi.org/10.1242/JEB.003939
Caballero-Florán, R. N., Conde-Rojas, I., Oviedo Chávez, A., Cortes-Calleja, H., LopezSantiago, L. F., Isom, L. L., Aceves, J., Erlij, D., & Florán, B. (2016). Cannabinoidinduced depression of synaptic transmission is switched to stimulation when
dopaminergic tone is increased in the globus pallidus of the rodent.
Neuropharmacology, 110(Pt A), 407–418.
https://doi.org/10.1016/J.NEUROPHARM.2016.08.002
Cascio, M. G., & Marini, P. (2015). Biosynthesis and Fate of Endocannabinoids.
Handbook of Experimental Pharmacology, 231, 39–58. https://doi.org/10.1007/9783-319-20825-1_2
Centonze, D., Bari, M., Rossi, S., Prosperetti, C., Furlan, R., Fezza, F., de Chiara, V.,
Battistini, L., Bernardi, G., Bernardini, S., Martino, G., & Maccarrone, M. (2007).
The endocannabinoid system is dysregulated in multiple sclerosis and in
experimental autoimmune encephalomyelitis. Brain : A Journal of Neurology,
130(Pt 10), 2543–2553. https://doi.org/10.1093/BRAIN/AWM160
Chang, N., Sun, C., Gao, L., Zhu, D., Xu, X., Zhu, X., Xiong, J. W., & Xi, J. J. (2013).
Genome editing with RNA-guided Cas9 nuclease in Zebrafish embryos. Cell
Research 2013 23:4, 23(4), 465–472. https://doi.org/10.1038/cr.2013.45
Chiang, Y. C., Lo, Y. N., & Chen, J. C. (2013). Crosstalk between dopamine D₂
receptors and cannabinoid CB₁ receptors regulates CNR1 promoter activity via
ERK1/2 signaling. Journal of Neurochemistry, 127(2), 163–176.
https://doi.org/10.1111/JNC.12399
Chicaybam, L., Barcelos, C., Peixoto, B., Carneiro, M., Limia, C. G., Redondo, P., Lira,
C., Paraguassú-Braga, F., Vasconcelos, Z. F. M. de, Barros, L., & Bonamino, M. H.
(2017). An Efficient Electroporation Protocol for the Genetic Modification of
Mammalian Cells. Frontiers in Bioengineering and Biotechnology, 4, 99.
https://doi.org/10.3389/FBIOE.2016.00099/BIBTEX
Choi, T. Y., Choi, T. I., Lee, Y. R., Choe, S. K., & Kim, C. H. (2021). Zebrafish as an
animal model for biomedical research. Experimental & Molecular Medicine, 53(3),
310. https://doi.org/10.1038/S12276-021-00571-5
Clapper, J. R., Moreno-Sanz, G., Russo, R., Guijarro, A., Vacondio, F., Duranti, A.,
Tontini, A., Sanchini, S., Sciolino, N. R., Spradley, J. M., Hohmann, A. G.,

84

Calignano, A., Mor, M., Tarzia, G., & Piomelli, D. (2010). Anandamide suppresses
pain initiation through a peripheral endocannabinoid mechanism. Nature
Neuroscience, 13(10), 1265. https://doi.org/10.1038/NN.2632
Colangeli, R., Teskey, G. C., & di Giovanni, G. (2021). Endocannabinoid-serotonin
systems interaction in health and disease. Progress in Brain Research, 259, 83–134.
https://doi.org/10.1016/BS.PBR.2021.01.003
Connors, K. A., Valenti, T. W., Lawless, K., Sackerman, J., Onaivi, E. S., Brooks, B. W.,
& Gould, G. G. (2014a). Similar anxiolytic effects of agonists targeting serotonin 5HT1A or cannabinoid CB receptors on zebrafish behavior in novel environments.
Aquatic Toxicology (Amsterdam, Netherlands), 151, 105.
https://doi.org/10.1016/J.AQUATOX.2013.12.005
Connors, K. A., Valenti, T. W., Lawless, K., Sackerman, J., Onaivi, E. S., Brooks, B. W.,
& Gould, G. G. (2014b). Similar anxiolytic effects of agonists targeting serotonin 5HT1A or cannabinoid CB receptors on zebrafish behavior in novel environments.
Aquatic Toxicology, 151, 105–113.
https://doi.org/10.1016/J.AQUATOX.2013.12.005
Console-Bram, L., Marcu, J., & Abood, M. E. (2012). Cannabinoid Receptors:
Nomenclature and Pharmacological Principles. Progress in NeuroPsychopharmacology & Biological Psychiatry, 38(1), 4.
https://doi.org/10.1016/J.PNPBP.2012.02.009
Corporation, P. (n.d.). Monitoring the activity of G protein-coupled receptors (GPCRs)
modulated by lipid or free fatty acid agonists. www.promega.com
Costa, B., Trovato, A. E., Comelli, F., Giagnoni, G., & Colleoni, M. (2007). The nonpsychoactive cannabis constituent cannabidiol is an orally effective therapeutic
agent in rat chronic inflammatory and neuropathic pain. European Journal of
Pharmacology, 556(1–3), 75–83. https://doi.org/10.1016/J.EJPHAR.2006.11.006
Cristino, L., Bisogno, T., & di Marzo, V. (2020). Cannabinoids and the expanded
endocannabinoid system in neurological disorders. Nature Reviews. Neurology,
16(1), 9–29. https://doi.org/10.1038/S41582-019-0284-Z
Cui, Y., Xu, J., Cheng, M., Liao, X., & Peng, S. (2018). Review of CRISPR/Cas9 sgRNA
Design Tools. Interdisciplinary Sciences: Computational Life Sciences 2018 10:2,
10(2), 455–465. https://doi.org/10.1007/S12539-018-0298-Z
Daniel, H., Rancillac, A., & Crepel, F. (2004a). Mechanisms underlying cannabinoid
inhibition of presynaptic Ca2+ influx at parallel fibre synapses of the rat cerebellum.
The Journal of Physiology, 557(Pt 1), 159.
https://doi.org/10.1113/JPHYSIOL.2004.063263
Daniel, H., Rancillac, A., & Crepel, F. (2004b). Mechanisms underlying cannabinoid
inhibition of presynaptic Ca2+ influx at parallel fibre synapses of the rat cerebellum.
The Journal of Physiology, 557(Pt 1), 159.
https://doi.org/10.1113/JPHYSIOL.2004.063263
di Blasi, R., Marbiah, M. M., Siciliano, V., Polizzi, K., & Ceroni, F. (2021). A call for
caution in analysing mammalian co-transfection experiments and implications of
resource competition in data misinterpretation. Nature Communications 2021 12:1,
12(1), 1–6. https://doi.org/10.1038/s41467-021-22795-9
Diez-Alarcia, R., Ibarra-Lecue, I., Lopez-Cardona, Á. P., Meana, J., Gutierrez-Adán, A.,
Callado, L. F., Agirregoitia, E., & Urigüen, L. (2016). Biased agonism of three

85

different cannabinoid receptor agonists in mouse brain cortex. Frontiers in
Pharmacology, 7(NOV). https://doi.org/10.3389/FPHAR.2016.00415/FULL
Doench, J. G., Fusi, N., Sullender, M., Hegde, M., Vaimberg, E. W., Donovan, K. F.,
Smith, I., Tothova, Z., Wilen, C., Orchard, R., Virgin, H. W., Listgarten, J., & Root,
D. E. (2016). Optimized sgRNA design to maximize activity and minimize offtarget effects of CRISPR-Cas9. Nature Biotechnology 2015 34:2, 34(2), 184–191.
https://doi.org/10.1038/nbt.3437
Domenicali, M., Ros, J., Fernández-Varo, G., Cejudo-Martín, P., Crespo, M., MoralesRuiz, M., Briones, A. M., Campistol, J. M., Arroyo, V., Vila, E., Rodés, J., &
Jiménez, W. (2005). Increased anandamide induced relaxation in mesenteric arteries
of cirrhotic rats: role of cannabinoid and vanilloid receptors. Gut, 54(4), 522.
https://doi.org/10.1136/GUT.2004.051599
Dupré, D. J., & Hébert, T. E. (2018). G Protein Beta/Gamma. Encyclopedia of Signaling
Molecules, 1919–1927. https://doi.org/10.1007/978-3-319-67199-4_75
Easter, S. S., & Nicola, G. N. (1996). The development of vision in the zebrafish (Danio
rerio). Developmental Biology, 180(2), 646–663.
https://doi.org/10.1006/dbio.1996.0335
Eaton, R. C., Lee, R. K. K., & Foreman, M. B. (2001). The Mauthner cell and other
identified neurons of the brainstem escape network of fish. Progress in
Neurobiology, 63(4), 467–485. https://doi.org/10.1016/S0301-0082(00)00047-2
Emran, F., Rihel, J., & Dowling, J. E. (2008). A behavioral assay to measure
responsiveness of Zebrafish to changes in light intensities. Journal of Visualized
Experiments, 20. https://doi.org/10.3791/923
Evanko, D. S., Thiyagarajan, M. M., Siderovski, D. P., & Wedegaertner, P. B. (2001).
Gβγ Isoforms Selectively Rescue Plasma Membrane Localization and
Palmitoylation of Mutant Gαs and Gαq. Journal of Biological Chemistry, 276(26),
23945–23953. https://doi.org/10.1074/jbc.M101154200
Evanko, D. S., Thiyagarajan, M. M., & Wedegaertner, P. B. (2000). Interaction with
Gbetagamma is required for membrane targeting and palmitoylation of Galpha(s)
and Galpha(q). The Journal of Biological Chemistry, 275(2), 1327–1336.
https://doi.org/10.1074/JBC.275.2.1327
Functional CB1 cannabinoid receptors in human vascular endothelial cells - PubMed.
(n.d.). Retrieved October 15, 2022, from
https://pubmed.ncbi.nlm.nih.gov/10698714/
Ganzen, L., Ko, M. J., Zhang, M., Xie, R., Chen, Y., Zhang, L., James, R., Mumm, J.,
van Rijn, R. M., Zhong, W., Pang, C. P., Zhang, M., Tsujikawa, M., & Leung, Y. F.
(2021). Drug screening with zebrafish visual behavior identifies carvedilol as a
potential treatment for an autosomal dominant form of retinitis pigmentosa.
Scientific Reports, 11(1). https://doi.org/10.1038/S41598-021-89482-Z
Germini, D., Tsfasman, T., Zakharova, V. v., Sjakste, N., Lipinski, M., & Vassetzky, Y.
(2018). A Comparison of Techniques to Evaluate the Effectiveness of Genome
Editing. Trends in Biotechnology, 36(2), 147–159.
https://doi.org/10.1016/J.TIBTECH.2017.10.008
Ghaderi, D., Zhang, M., Hurtado-Ziola, N., & Varki, A. (2012). Production platforms for
biotherapeutic glycoproteins. Occurrence, impact, and challenges of non-human

86

sialylation. Biotechnology & Genetic Engineering Reviews, 28, 147–176.
https://doi.org/10.5661/BGER-28-147
Glass, M., & Felder, C. C. (1997). Concurrent stimulation of cannabinoid CB1 and
dopamine D2 receptors augments cAMP accumulation in striatal neurons: evidence
for a Gs linkage to the CB1 receptor. The Journal of Neuroscience : The Official
Journal of the Society for Neuroscience, 17(14), 5327–5333.
https://doi.org/10.1523/JNEUROSCI.17-14-05327.1997
Gómez, R., Navarro, M., Ferrer, B., Trigo, J. M., Bilbao, A., Arco, I. del, Cippitelli, A.,
Nava, F., Piomelli, D., & de Fonseca, F. R. (2002). A peripheral mechanism for CB1
cannabinoid receptor-dependent modulation of feeding. The Journal of
Neuroscience : The Official Journal of the Society for Neuroscience, 22(21), 9612–
9617. https://doi.org/10.1523/JNEUROSCI.22-21-09612.2002
González-Mariscal, I., Krzysik-Walker, S. M., Doyle, M. E., Liu, Q. R., Cimbro, R.,
Santa-Cruz Calvo, S., Ghosh, S., Cieala, A., Moaddel, R., Carlson, O. D., Witek, R.
P., O’Connell, J. F., & Egan, J. M. (2016). Human CB1 Receptor Isoforms, present
in Hepatocytes and β-cells, are Involved in Regulating Metabolism. Scientific
Reports, 6. https://doi.org/10.1038/SREP33302
Grunwald, D. J., & Eisen, J. S. (2002). Headwaters of the zebrafish - emergence of a new
model vertebrate. Nature Reviews Genetics, 3(9), 717–724.
https://doi.org/10.1038/nrg892
Hampson, R. E., Mu, J., & Deadwyler, S. A. (2000). Cannabinoid and kappa opioid
receptors reduce potassium K current via activation of G(s) proteins in cultured
hippocampal neurons. Journal of Neurophysiology, 84(5), 2356–2364.
https://doi.org/10.1152/JN.2000.84.5.2356
Hegyi, Z., Oláh, T., Kőszeghy, Á., Piscitelli, F., Holló, K., Pál, B., Csernoch, L., Marzo,
V. di, & Antal, M. (n.d.). CB 1 receptor activation induces intracellular Ca 2+
mobilization and 2-arachidonoylglycerol release in rodent spinal cord astrocytes
OPEN. https://doi.org/10.1038/s41598-018-28763-6
Hill, M. N., & Tasker, J. G. (2012). Endocannabinoid signaling, glucocorticoid-mediated
negative feedback, and regulation of the hypothalamic-pituitary-adrenal axis.
Neuroscience, 204, 5–16. https://doi.org/10.1016/J.NEUROSCIENCE.2011.12.030
Hollmann, M. W., Strumper, D., Herroeder, S., & Durieux, M. E. (2005). Receptors, G
Proteins, and Their Interactions. Anesthesiology, 103(5), 1066–1078.
https://doi.org/10.1097/00000542-200511000-00022
Howe, K., Clark, M. D., Torroja, C. F., Torrance, J., Berthelot, C., Muffato, M., Collins,
J. E., Humphray, S., McLaren, K., Matthews, L., McLaren, S., Sealy, I., Caccamo,
M., Churcher, C., Scott, C., Barrett, J. C., Koch, R., Rauch, G. J., White, S., …
Stemple, D. L. (2013). The zebrafish reference genome sequence and its relationship
to the human genome. Nature, 496(7446), 498.
https://doi.org/10.1038/NATURE12111
Howlett, A. C. (1985). Cannabinoid inhibition of adenylate cyclase. Biochemistry of the
response in neuroblastoma cell membranes. Molecular Pharmacology, 27(4), 429–
436.
Howlett, A. C. (1987). Cannabinoid inhibition of adenylate cyclase: relative activity of
constituents and metabolites of marihuana. Neuropharmacology, 26(5), 507–512.
https://doi.org/10.1016/0028-3908(87)90035-9

87

Hu Psychopharmacology, S., Shu-Jung Hu, S., Liu, Y.-W., & Yu, L. (n.d.). Medial
prefrontal cannabinoid CB1 receptors modulate consolidation and extinction of
cocaine-associated memory i... Medial prefrontal cannabinoid CB 1 receptors
modulate consolidation and extinction of cocaine-associated memory in mice.
https://doi.org/10.1007/s00213-014-3812-y
Hurowitz, E. H., Melnyk, J. M., Chen, Y. J., Kouros-Mehr, H., Simon, M. I., & Shizuya,
H. (2000). Genomic characterization of the human heterotrimeric G protein alpha,
beta, and gamma subunit genes. DNA Research : An International Journal for Rapid
Publication of Reports on Genes and Genomes, 7(2), 111–120.
https://doi.org/10.1093/DNARES/7.2.111
Hynes, T. R., Mervine, S. M., Yost, E. A., Sabo, J. L., & Berlot, C. H. (2004). Live cell
imaging of Gs and the beta2-adrenergic receptor demonstrates that both alphas and
beta1gamma7 internalize upon stimulation and exhibit similar trafficking patterns
that differ from that of the beta2-adrenergic receptor. The Journal of Biological
Chemistry, 279(42), 44101–44112. https://doi.org/10.1074/JBC.M405151200
Kain, S. R., & Ganguly, S. (2004). Overview of Genetic Reporter Systems. Current
Protocols in Molecular Biology, 68(1), 9.6.1-9.6.12.
https://doi.org/10.1002/0471142727.MB0906S36
Kato, A., Punnakkal, P., Pernía-Andrade, A. J., von Schoultz, C., Sharopov, S., Nyilas,
R., Katona, I., & Zeilhofer, H. U. (2012). Endocannabinoid-dependent plasticity at
spinal nociceptor synapses. The Journal of Physiology, 590(19), 4717–4733.
https://doi.org/10.1113/JPHYSIOL.2012.234229
Katona, I., Sperlágh, B., Sík, A., Käfalvi, A., Vizi, E. S., Mackie, K., & Freund, T. F.
(1999). Presynaptically located CB1 cannabinoid receptors regulate GABA release
from axon terminals of specific hippocampal interneurons. The Journal of
Neuroscience : The Official Journal of the Society for Neuroscience, 19(11), 4544–
4558. https://doi.org/10.1523/JNEUROSCI.19-11-04544.1999
Kelly, G. M., Saijoh, Y., Finkielsztein, A., & Magnos, S. (2008). Mouse G-protein
gamma3 expression in the developing CNS and neural crest cell derivatives. The
International Journal of Developmental Biology, 52(8), 1143–1150.
https://doi.org/10.1387/IJDB.072561GK
Kelly, G. M., Vanderbeld, B., Krawetz, R., & Mangos, S. (2001). Differential distribution
of the G protein γ3 subunit in the developing zebrafish nervous system.
International Journal of Developmental Neuroscience, 19(4), 455–467.
https://doi.org/10.1016/S0736-5748(01)00002-8
Kerr, D. S., von Dannecker, E. C., Davalos, M., Michaloski, J. S., & Malnic, B. (2008).
Ric-8B interacts with Gαolf and Gγ13 and co-localizes with Gαolf, Gβ1 and Gγ13
in the cilia of olfactory sensory neurons. https://doi.org/10.1016/j.mcn.2008.03.006
Khan, S. M., Sleno, R., Gora, S., Zylbergold, P., Laverdure, J. P., Labbé, J. C., Miller, G.
J., & Hébert, T. E. (2013). The expanding roles of Gβγ subunits in G proteincoupled receptor signaling and drug action. Pharmacological Reviews, 65(2), 545–
577. https://doi.org/10.1124/PR.111.005603
Kilaru, A., & Chapma, K. D. (2020). The endocannabinoid system. Essays in
Biochemistry, 64(3), 485–499. https://doi.org/10.1042/EBC20190086

88

Kim, T. K., & Eberwine, J. H. (2010). Mammalian cell transfection: the present and the
future. Analytical and Bioanalytical Chemistry, 397(8), 3173.
https://doi.org/10.1007/S00216-010-3821-6
Kleuss, C., Scherübl, H., Hescheler, J., Schultz, G., & Wittig, B. (1993). Selectivity in
Signal Transduction Determined by γ Subunits of Heterotrimeric G Proteins.
Science, 259(5096), 832–834. https://doi.org/10.1126/SCIENCE.8094261
Kohashi, T., Nakata, N., & Oda, Y. (2012). Effective Sensory Modality Activating an
Escape Triggering Neuron Switches during Early Development in Zebrafish.
Journal of Neuroscience, 32(17), 5810–5820.
https://doi.org/10.1523/JNEUROSCI.6169-11.2012
Koide, T., Yabuki, Y., & Yoshihara Correspondence, Y. (2018). Terminal Nerve GnRH3
Neurons Mediate Slow Avoidance of Carbon Dioxide in Larval Zebrafish. Cell
Reports, 22, 1115–1123. https://doi.org/10.1016/j.celrep.2018.01.019
Kolesnikov, A. v., Rikimaru, L., Hennig, A. K., Lukasiewicz, P. D., Fliesler, S. J.,
Govardovskii, V. I., Kefalov, V. J., & Kisselev, O. G. (2011). G-protein betagammacomplex is crucial for efficient signal amplification in vision. The Journal of
Neuroscience : The Official Journal of the Society for Neuroscience, 31(22), 8067–
8077. https://doi.org/10.1523/JNEUROSCI.0174-11.2011
Krishna Kumar, K., Shalev-Benami, M., Robertson, M. J., Hu, H., Banister, S. D.,
Hollingsworth, S. A., Latorraca, N. R., Kato, H. E., Hilger, D., Maeda, S., Weis, W.
I., Farrens, D. L., Dror, R. O., Malhotra, S. v., Kobilka, B. K., & Skiniotis, G.
(2019). Structure of a Signaling Cannabinoid Receptor 1-G Protein Complex. Cell,
176(3), 448-458.e12. https://doi.org/10.1016/J.CELL.2018.11.040
Krug, R. G., & Clark, K. J. (2015). Elucidating cannabinoid biology in zebrafish (Danio
rerio). Gene, 570(2), 168–179. https://doi.org/10.1016/J.GENE.2015.07.036
Kumar, M., Hsiao, K., Vidugiriene, J., & Goueli, S. A. (2007). A bioluminescent-based,
HTS-compatible assay to monitor G-protein-coupled receptor modulation of cellular
cyclic AMP. Assay and Drug Development Technologies, 5(2), 237–245.
https://doi.org/10.1089/ADT.2006.055
Lai, T., Yang, Y., & Ng, S. K. (2013). Advances in Mammalian Cell Line Development
Technologies for Recombinant Protein Production. Pharmaceuticals, 6(5), 579.
https://doi.org/10.3390/PH6050579
Lam, C. S., Rastegar, S., & Strähle, U. (2006). Distribution of cannabinoid receptor 1 in
the CNS of zebrafish. Neuroscience, 138(1), 83–95.
https://doi.org/10.1016/j.neuroscience.2005.10.069
Langmead, B., Trapnell, C., Pop, M., & Salzberg, S. L. (2009). Ultrafast and memoryefficient alignment of short DNA sequences to the human genome. Genome Biology,
10(3). https://doi.org/10.1186/GB-2009-10-3-R25
Lauckner, J. E., Hille, B., & Mackie, K. (2005). The cannabinoid agonist WIN55,212-2
increases intracellular calcium via CB1 receptor coupling to Gq/11 G proteins.
Proceedings of the National Academy of Sciences, 102(52), 19144–19149.
https://doi.org/10.1073/PNAS.0509588102
Leung, T. C., Chen, H., Stauffer, A. M., Giger, K. E., Sinha, S., Horstick, E. J., Humbert,
J. E., Hansen, C. A., & Robishaw, J. D. (2006). Zebrafish G protein γ2 is required
for VEGF signaling during angiogenesis. Blood, 108(1), 160–166.
https://doi.org/10.1182/blood-2005-09-3706

89

Lewis, S. E. M., Rapino, C., di Tommaso, M., Pucci, M., Battista, N., Paro, R., Simon,
L., Lutton, D., & Maccarrone, M. (2012). Differences in the Endocannabinoid
System of Sperm from Fertile and Infertile Men. PLOS ONE, 7(10), e47704.
https://doi.org/10.1371/JOURNAL.PONE.0047704
Lobanova, E. S., Finkelstein, S., Herrmann, R., Chen, Y. M., Kessler, C., Michaud, N.
A., Trieu, L. H., Strissel, K. J., Burns, M. E., & Arshavsky, V. Y. (2008).
Transducin γ-Subunit Sets Expression Levels of α- and β-Subunits and Is Crucial
for Rod Viability. The Journal of Neuroscience, 28(13), 3510.
https://doi.org/10.1523/JNEUROSCI.0338-08.2008
Lötsch, J., Weyer-Menkhoff, I., & Tegeder, I. (2018). Current evidence of cannabinoidbased analgesia obtained in preclinical and human experimental settings. European
Journal of Pain (London, England), 22(3), 471–484.
https://doi.org/10.1002/EJP.1148
Luchtenburg, F. J., Schaaf, M. J. M., & Richardson, M. K. (2019). Functional
characterization of the cannabinoid receptors 1 and 2 in zebrafish larvae using
behavioral analysis. Psychopharmacology, 236(7), 2049–2058.
https://doi.org/10.1007/S00213-019-05193-4/FIGURES/8
Lukov, G. L., Baker, C. M., Ludtke, P. J., Hu, T., Carter, M. D., Hackett, R. A., Thulin,
C. D., & Willardson, B. M. (2006). Mechanism of assembly of G protein
betagamma subunits by protein kinase CK2-phosphorylated phosducin-like protein
and the cytosolic chaperonin complex. The Journal of Biological Chemistry,
281(31), 22261–22274. https://doi.org/10.1074/JBC.M601590200
Macrez, N., Morel, J. L., Kalkbrenner, F., Viard, P., Schultz, G., & Mironneau, J. (1997).
A betagamma dimer derived from G13 transduces the angiotensin AT1 receptor
signal to stimulation of Ca2+ channels in rat portal vein myocytes. The Journal of
Biological Chemistry, 272(37), 23180–23185.
https://doi.org/10.1074/JBC.272.37.23180
Maeda, N., Osanai, T., Kushibiki, M., Fujiwara, T., Tamura, Y., Oowada, S., Higuma, T.,
Sasaki, S., Yokoyama, J., Yoshimachi, F., Matsunaga, T., Hanada, H., & Okumura,
K. (2009). Increased serum anandamide level at ruptured plaque site in patients with
acute myocardial infarction. Fundamental & Clinical Pharmacology, 23(3), 351–
357. https://doi.org/10.1111/J.1472-8206.2009.00679.X
Marrari, Y., Crouthamel, M., Irannejad, R., & Wedegaertner, P. B. (2007). Assembly and
trafficking of heterotrimeric G proteins. Biochemistry, 46(26), 7665–7677.
https://doi.org/10.1021/BI700338M
Matsuda, L. A., Lolait, S. J., Brownstein, M. J., Young, A. C., & Bonner, T. I. (1990).
Structure of a cannabinoid receptor and functional expression of the cloned cDNA.
Nature, 346(6284), 561–564. https://doi.org/10.1038/346561A0
Mefferd, A. L., Kornepati, A. V. R., Bogerd, H. P., Kennedy, E. M., & Cullen, B. R.
(2015). Expression of CRISPR/Cas single guide RNAs using small tRNA
promoters. RNA, 21(9), 1683. https://doi.org/10.1261/RNA.051631.115
Migliarini, B., & Carnevali, O. (2009). A novel role for the endocannabinoid system
during zebrafish development. Molecular and Cellular Endocrinology, 299(2), 172–
177. https://doi.org/10.1016/J.MCE.2008.11.014
Moon, A. M., Stauffer, A. M., Schwindinger, W. F., Sheridan, K., Firment, A., &
Robishaw, J. D. (2014a). Disruption of G-protein γ5 subtype causes embryonic

90

lethality in mice. PloS One, 9(3).
https://doi.org/10.1371/JOURNAL.PONE.0090970
Moon, A. M., Stauffer, A. M., Schwindinger, W. F., Sheridan, K., Firment, A., &
Robishaw, J. D. (2014b). Disruption of G-protein γ5 subtype causes embryonic
lethality in mice. PloS One, 9(3).
https://doi.org/10.1371/JOURNAL.PONE.0090970
Moreno, E., Chiarlone, A., Medrano, M., Puigdellívol, M., Bibic, L., Howell, L. A.,
Resel, E., Puente, N., Casarejos, M. J., Perucho, J., Botta, J., Suelves, N., Ciruela, F.,
Ginés, S., Galve-Roperh, I., Casadó, V., Grandes, P., Lutz, B., Monory, K., …
Guzmán, M. (2018). Singular Location and Signaling Profile of Adenosine A2ACannabinoid CB1 Receptor Heteromers in the Dorsal Striatum.
Neuropsychopharmacology : Official Publication of the American College of
Neuropsychopharmacology, 43(5), 964–977. https://doi.org/10.1038/NPP.2017.12
Morishita, R., Saga, S., Kawamura, N., Hashizume, Y., Inagaki, T., Kato, K., & Asano,
T. (1997). Differential Localization of the γ3 and γ12 Subunits of G Proteins in the
Mammalian Brain. Journal of Neurochemistry, 68(2), 820–827.
https://doi.org/10.1046/J.1471-4159.1997.68020820.X
Muller, C., Lynch, D. L., Hurst, D. P., & Reggio, P. H. (2021). TRPV1 Activation by
Anandamide via a Unique Lipid Pathway. Journal of Chemical Information and
Modeling, 61(12), 5742–5746.
https://doi.org/10.1021/ACS.JCIM.1C00893/ASSET/IMAGES/LARGE/CI1C00893
_0004.JPEG
Muller, C., Morales, P., & Reggio, P. H. (2018). Cannabinoid Ligands Targeting TRP
Channels. Frontiers in Molecular Neuroscience, 11.
https://doi.org/10.3389/FNMOL.2018.00487
Muller, N., Derouazi, M., van Tilborgh, F., Wulhfard, S., Hacker, D. L., Jordan, M., &
Wurm, F. M. (2007). Scalable transient gene expression in Chinese hamster ovary
cells in instrumented and non-instrumented cultivation systems. Biotechnology
Letters, 29(5), 703–711. https://doi.org/10.1007/S10529-006-9298-X
Mumby, S. M., Heukeroth, R. O., Gordon, J. I., & Gilman, A. G. (1990). G-protein
alpha-subunit expression, myristoylation, and membrane association in COS cells.
Proceedings of the National Academy of Sciences of the United States of America,
87(2), 728. https://doi.org/10.1073/PNAS.87.2.728
Murray, D., McLaughlin, S., & Honig, B. (2001). The role of electrostatic interactions in
the regulation of the membrane association of G protein beta gamma heterodimers.
The Journal of Biological Chemistry, 276(48), 45153–45159.
https://doi.org/10.1074/JBC.M101784200
Nasiadka, A., & Clark, M. D. (2012). Zebrafish breeding in the laboratory environment.
ILAR Journal, 53(2), 161–168. https://doi.org/10.1093/ILAR.53.2.161
Navarrete, M., & Araque, A. (2010). Endocannabinoids potentiate synaptic transmission
through stimulation of astrocytes. Neuron, 68(1), 113–126.
https://doi.org/10.1016/J.NEURON.2010.08.043
Neefjes, M., Housmans, B. A. C., van den Akker, G. G. H., van Rhijn, L. W., Welting, T.
J. M., & van der Kraan, P. M. (2021). Reporter gene comparison demonstrates
interference of complex body fluids with secreted luciferase activity. Scientific
Reports 2021 11:1, 11(1), 1–13. https://doi.org/10.1038/s41598-020-80451-6

91

Neuhauss, S. C. F. (2003). Behavioral genetic approaches to visual system development
and function in zebrafish. Journal of Neurobiology, 54(1), 148–160.
https://doi.org/10.1002/NEU.10165
Nicolussi, S., & Gertsch, J. (2015). Endocannabinoid transport revisited. Vitamins and
Hormones, 98, 441–485. https://doi.org/10.1016/BS.VH.2014.12.011
Niedernberg, A., Tunaru, S., Blaukat, A., Harris, B., & Kostenis, E. (2003). Comparative
Analysis of Functional Assays for Characterization of Agonist Ligands at G ProteinCoupled Receptors. https://doi.org/10.1177/1087057103257555
Onaivi, E. S., Chaudhuri, G., Abaci, A. S., Parker, M., Manier, D. H., Martin, P. R., &
Hubbard, J. R. (1999). Expression of cannabinoid receptors and their gene
transcripts in human blood cells. Progress in Neuro-Psychopharmacology and
Biological Psychiatry, 23(6), 1063–1077. https://doi.org/10.1016/S02785846(99)00052-4
Orger, M. B., & Baier, H. (2005). Channeling of red and green cone inputs to the
zebrafish optomotor response. Visual Neuroscience, 22(3), 275–281.
https://doi.org/10.1017/S0952523805223039
O’Shaughnessy, W. B. (1831). POISONED CONFECTIONARY. DETECTION OF
GAMBOGF, LEAD, COPPER, MERCURY, AND CHROMATE OF LEAD. In
various articles of Sugar Confectionary. The Lancet, 16(402), 193–198.
https://doi.org/10.1016/S0140-6736(02)93776-1
Pantoja, C., Hoagland, A., Carroll, E. C., Karalis, V., Conner, A., & Isacoff, E. Y. (2016).
Neuromodulatory Regulation of Behavioral Individuality in Zebrafish. Neuron,
91(3), 587–601. https://doi.org/10.1016/j.neuron.2016.06.016
Peng, Y. W., Robishaw, J. D., Levine, M. A., & Yau, K. W. (1992). Retinal rods and
cones have distinct G protein beta and gamma subunits. Proceedings of the National
Academy of Sciences of the United States of America, 89(22), 10882.
https://doi.org/10.1073/PNAS.89.22.10882
Pertwee, R. G. (2007). GPR55: a new member of the cannabinoid receptor clan? British
Journal of Pharmacology, 152(7), 984–986. https://doi.org/10.1038/SJ.BJP.0707464
Prather, P. L., Martin, N. A., Breivogel, C. S., & Childers, S. R. (2000). Activation of
Cannabinoid Receptors in Rat Brain by WIN 55212-2 Produces Coupling to
Multiple G Protein α-Subunits with Different Potencies. Molecular Pharmacology,
57(5).
Priestley, R., Glass, M., & Kendall, D. (2017). Functional Selectivity at Cannabinoid
Receptors. Advances in Pharmacology, 80, 207–221.
https://doi.org/10.1016/BS.APHA.2017.03.005
Puhl, S. L. (2020). Cannabinoid-sensitive receptors in cardiac physiology and ischaemia.
Biochimica et Biophysica Acta. Molecular Cell Research, 1867(3).
https://doi.org/10.1016/J.BBAMCR.2019.03.009
Rácz, I., Nent, E., Erxlebe, E., & Zimmer, A. (2015). CB1 receptors modulate affective
behaviour induced by neuropathic pain. Brain Research Bulletin, 114, 42–48.
https://doi.org/10.1016/J.BRAINRESBULL.2015.03.005
Raquel Gómez 1, M. N. (n.d.). A peripheral mechanism for CB1 cannabinoid receptordependent modulation of feeding - PubMed. Retrieved October 15, 2022, from
https://pubmed.ncbi.nlm.nih.gov/12417686/

92

Richardson, M., & Robishaw, J. D. (1999). The alpha2A-adrenergic receptor
discriminates between Gi heterotrimers of different betagamma subunit composition
in Sf9 insect cell membranes. The Journal of Biological Chemistry, 274(19), 13525–
13533. https://doi.org/10.1074/JBC.274.19.13525
Roberts, A. C., Reichl, J., Song, M. Y., Dearinger, A. D., Moridzadeh, N., Lu, E. D.,
Pearce, K., Esdin, J., & Glanzman, D. L. (2011). Habituation of the C-Start
Response in Larval Zebrafish Exhibits Several Distinct Phases and Sensitivity to
NMDA Receptor Blockade. PLOS ONE, 6(12), e29132.
https://doi.org/10.1371/JOURNAL.PONE.0029132
Röpke, J., Ferreira-Vieira, T. H., Iglesias, L. P., Asth, L., Ribeiro, F. M., & Moreira, F.
A. (2021). Protective role of endocannabinoid signaling in an animal model of
haloperidol-induced tardive dyskinesia. Pharmacology, Biochemistry, and Behavior,
206. https://doi.org/10.1016/J.PBB.2021.173193
Ruhl, T., Zeymer, M., & von der Emde, G. (2017). Cannabinoid modulation of zebrafish
fear learning and its functional analysis investigated by c-Fos expression.
Pharmacology, Biochemistry, and Behavior, 153, 18–31.
https://doi.org/10.1016/J.PBB.2016.12.005
Sadovski, O., Hicks, J. W., Parkes, J., Raymond, R., Nobrega, J., Houle, S., Cipriano, M.,
Fowler, C. J., Vasdev, N., & Wilson, A. A. (2013). Development and
characterization of a promising fluorine-18 labelled radiopharmaceutical for in vivo
imaging of fatty acid amide hydrolase. Bioorganic and Medicinal Chemistry,
21(14), 4351–4357. https://doi.org/10.1016/j.bmc.2013.04.077
Salomon, Y., Londos, C., & Rodbell, M. (1974). A highly sensitive adenylate cyclase
assay. Analytical Biochemistry, 58(2), 541–548. https://doi.org/10.1016/00032697(74)90222-X
Saporito-Irwin, S. M., Geist, T., & Gutmann, D. H. (1997). Ammonium acetate protocol
for the preparation of plasmid DNA suitable for mammalian cell transfections.
BioTechniques, 23(3), 424–427. https://doi.org/10.2144/97233BM16
Saroz, Y., Kho, D. T., Glass, M., Graham, E. S., & Grimsey, N. L. (2019). Cannabinoid
Receptor 2 (CB2) Signals via G-alpha-s and Induces IL-6 and IL-10 Cytokine
Secretion in Human Primary Leukocytes. ACS Pharmacology and Translational
Science, 2(6), 414–428.
https://doi.org/10.1021/ACSPTSCI.9B00049/ASSET/IMAGES/MEDIUM/PT9B00
049_M001.GIF
Schwindinger, W. F., Borrell, B. M., Waldman, L. C., & Robishaw, J. D. (2009). Mice
lacking the G protein gamma3-subunit show resistance to opioids and diet induced
obesity. American Journal of Physiology. Regulatory, Integrative and Comparative
Physiology, 297(5). https://doi.org/10.1152/AJPREGU.00308.2009
Schwindinger, W. F., Murphree Mihalcik, L. J., Giger, K. E., Betz, K. S., Stauffer, A. M.,
Linden, J., Herve, D., & Robishaw, J. D. (2010). Adenosine A2A receptor signaling
and golf assembly show a specific requirement for the gamma7 subtype in the
striatum. The Journal of Biological Chemistry, 285(39), 29787–29796.
https://doi.org/10.1074/JBC.M110.142620
Shu-Jung Hu, S., & Mackie, K. (2015). Distribution of the Endocannabinoid System in
the Central Nervous System. Handbook of Experimental Pharmacology, 231, 59–93.
https://doi.org/10.1007/978-3-319-20825-1_3

93

Sixpence, P., B O, B. W., & Army, B. (1843). On the Preparations of the Indian Hemp, or
Gunjah: Cannabis Indica Their Effects on the Animal System in Health, and their
Utility in the Treatment of Tetanus and other Convulsive Diseases. Provincial
Medical Journal and Retrospect of the Medical Sciences, 5(123), 363.
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2490264/
Smrcka, A. v. (2008). G protein βγ subunits: Central mediators of G protein-coupled
receptor signaling. Cellular and Molecular Life Sciences : CMLS, 65(14), 2191.
https://doi.org/10.1007/S00018-008-8006-5
Sorlien, E. L., Witucki, M. A., & Ogas, J. (2018). Efficient Production and Identification
of CRISPR/Cas9-generated Gene Knockouts in the Model System Danio rerio.
Journal of Visualized Experiments : JoVE, 2018(138). https://doi.org/10.3791/56969
Stanley, C. P., Hind, W. H., Tufarelli, C., & O’Sullivan, S. E. (2016). The
endocannabinoid anandamide causes endothelium-dependent vasorelaxation in
human mesenteric arteries. Pharmacological Research, 113(Pt A), 356–363.
https://doi.org/10.1016/J.PHRS.2016.08.028
Stewart, A. M., & Kalueff, A. v. (2014). The behavioral effects of acute Δ9tetrahydrocannabinol and heroin (diacetylmorphine) exposure in adult zebrafish.
Brain Research, 1543, 109–119. https://doi.org/10.1016/J.BRAINRES.2013.11.002
Sufian, S., Waldon, J., Kanyo, R., Allison, W. T., & Ali, D. W. (2018).
Endocannabinoids in Zebrafish are Necessary for Normal Development and
Locomotion. Ashdin Publishing Journal of Drug and Alcohol Research, 7, 9.
https://doi.org/10.4303/jdar/236063
Sugiura, T., Kodaka, T., Nakane, S., Miyashita, T., Kondo, S., Suhara, Y., Takayama, H.,
Waku, K., Seki, C., Baba, N., & Ishima, Y. (1999). Evidence that the cannabinoid
CB1 receptor is a 2-arachidonoylglycerol receptor. Structure-activity relationship of
2-arachidonoylglycerol, ether-linked analogues, and related compounds. The
Journal of Biological Chemistry, 274(5), 2794–2801.
https://doi.org/10.1074/JBC.274.5.2794
Syrovatkina, V., Alegre, K. O., Dey, R., & Huang, X. Y. (2016). Regulation, Signaling,
and Physiological Functions of G-Proteins. Journal of Molecular Biology, 428(19),
3850–3868. https://doi.org/10.1016/J.JMB.2016.08.002
Tubio, M. R., Fernandez, N., Fitzsimons, C. P., Copsel, S., Santiago, S., Shayo, C.,
Davio, C., & Monczor, F. (2010). Expression of a G Protein-coupled Receptor
(GPCR) Leads to Attenuation of Signaling by Other GPCRs: EXPERIMENTAL
EVIDENCE FOR A SPONTANEOUS GPCR CONSTITUTIVE INACTIVE
FORM*. The Journal of Biological Chemistry, 285(20), 14990.
https://doi.org/10.1074/JBC.M109.099689
Tuz-Sasik, M. U., Boije, H., & Manuel, R. (2022). Characterization of locomotor
phenotypes in zebrafish larvae requires testing under both light and dark conditions.
PloS One, 17(4). https://doi.org/10.1371/JOURNAL.PONE.0266491
Varshney, G. K., Pei, W., Lafave, M. C., Idol, J., Xu, L., Gallardo, V., Carrington, B.,
Bishop, K., Jones, M., Li, M., Harper, U., Huang, S. C., Prakash, A., Chen, W.,
Sood, R., Ledin, J., & Burgess, S. M. (2015). High-throughput gene targeting and
phenotyping in zebrafish using CRISPR/Cas9. Genome Research, 25(7), 1030–
1042. https://doi.org/10.1101/GR.186379.114

94

Vásquez, C., & Lewis, D. L. (1999). The CB1 Cannabinoid Receptor Can Sequester GProteins, Making Them Unavailable to Couple to Other Receptors. Journal of
Neuroscience, 19(21), 9271–9280. https://doi.org/10.1523/JNEUROSCI.19-2109271.1999
Vaz, R., Hofmeister, W., & Lindstrand, A. (2019). Zebrafish Models of
Neurodevelopmental Disorders: Limitations and Benefits of Current Tools and
Techniques. International Journal of Molecular Sciences, 20(6).
https://doi.org/10.3390/IJMS20061296
Veress, G., Meszar, Z., Muszil, D., Avelino, A., Matesz, K., Mackie, K., & Nagy, I.
(2013). Characterisation of cannabinoid 1 receptor expression in the perikarya, and
peripheral and spinal processes of primary sensory neurons. Brain Structure &
Function, 218(3), 733. https://doi.org/10.1007/S00429-012-0425-2
Watson, S., Chambers, D., Hobbs, C., Doherty, P., & Graham, A. (2008). The
endocannabinoid receptor, CB1, is required for normal axonal growth and
fasciculation. Molecular and Cellular Neuroscience, 38(1), 89–97.
https://doi.org/10.1016/J.MCN.2008.02.001
Weis, W. I., & Kobilka, B. K. (2018). The Molecular Basis of G Protein-Coupled
Receptor Activation. Annual Review of Biochemistry, 87, 897–919.
https://doi.org/10.1146/ANNUREV-BIOCHEM-060614-033910
Wiley, J. L., Owens, R. A., & Lichtman, A. H. (2018). Discriminative Stimulus
Properties of Phytocannabinoids, Endocannabinoids, and Synthetic Cannabinoids.
Current Topics in Behavioral Neurosciences, 39, 153–173.
https://doi.org/10.1007/7854_2016_24
Wong, M. L., & Medrano, J. F. (2005). Real-time PCR for mRNA quantitation.
BioTechniques, 39(1), 75–85.
https://doi.org/10.2144/05391RV01/ASSET/IMAGES/LARGE/TABLE2.JPEG
Woolston, C. (2021). ‘Does anyone have any of these?’: Lab-supply shortages strike
amid global pandemic. Nature. https://doi.org/10.1038/D41586-021-00613-Y
Wright, W. J., Schlüter, O. M., & Dong, Y. (2016). A Feedforward Inhibitory Circuit
Mediated by CB1-Expressing Fast-Spiking Interneurons in the Nucleus Accumbens.
Neuropsychopharmacology 2017 42:5, 42(5), 1146–1156.
https://doi.org/10.1038/npp.2016.275
Wu, X., Kriz, A. J., & Sharp, P. A. (2014). Target specificity of the CRISPR-Cas9
system. Quantitative Biology, 2(2), 59. https://doi.org/10.1007/S40484-014-0030-X
Xu, L., Guan, N. N., Huang, C. X., Hua, Y., & Song, J. (2021). A neuronal circuit that
generates the temporal motor sequence for the defensive response in zebrafish
larvae. Current Biology, 31(15), 3343-3357.e4.
https://doi.org/10.1016/J.CUB.2021.06.054
Zamberletti, E., Piscitelli, F., de Castro, V., Murru, E., Gabaglio, M., Colucci, P., Fanali,
C., Prini, P., Bisogno, T., Maccarrone, M., Campolongo, P., Banni, S., Rubino, T.,
& Parolaro, D. (2017). Lifelong imbalanced LA/ALA intake impairs emotional and
cognitive behavior via changes in brain endocannabinoid system. Journal of Lipid
Research, 58(2), 301–316. https://doi.org/10.1194/jlr.M068387
Zeddies, D. G., & Fay, R. R. (2005). Development of the acoustically evoked behavioral
response in zebrafish to pure tones. The Journal of Experimental Biology, 208(Pt 7),
1363–1372. https://doi.org/10.1242/JEB.01534

95

Zhang, H. Y., Fan, Z. L., & Wang, T. Y. (2021). Advances of Glycometabolism
Engineering in Chinese Hamster Ovary Cells. Frontiers in Bioengineering and
Biotechnology, 9, 1240. https://doi.org/10.3389/FBIOE.2021.774175/BIBTEX
Zhang, R., & Xie, X. (2012). Tools for GPCR drug discovery. Acta Pharmacologica
Sinica 2012 33:3, 33(3), 372–384. https://doi.org/10.1038/aps.2011.173
Zhang, T., Gao, Y., Wang, R., & Zhao, Y. (2017). Production of Guide RNAs in vitro
and in vivo for CRISPR Using Ribozymes and RNA Polymerase II Promoters. BioProtocol, 7(4). https://doi.org/10.21769/BIOPROTOC.2148

96

Figure 1: The Endogenous Cannabinoid System

97

Gα
Gαs , Gαolf

G-protein effector
Adenylate cyclase (+)

Gαo Gαi1-3 Gαt1,2 , Gαg , Gαz

Adenylate cyclase (-), cGMP
phosphodiesterase(+)
Phospholipase C-b (+),
p63RhoGEF
P115RhoGEF, PDZ-RhoGEF
Inwardly rectifying K+
channels (+)

Gαq , Gα11 Gα14 , Gα15/16
Gα12, Gα13

Gbg
Gb1g2
(Steiner et al., 2006)
Gb5g2, Gg2, Gb1
Gb1, Gg1, Gg2, Gg3, Gg13
(Huang L, et al 1999)
Gβ1, Gγ2
(Tabak et al., 2019)

Phosphoinositide 3-kinase
Gβ1-3g2
(PI3K)
Gαo Gαi1-3 , G α13
Voltage dependent Ca2+
Gβ2g2, Gγ3, Gβ1γ3
channels, SNAREs
Table 1: Non exhaustive table of G protein subunits and their effector pathways
(modified from D.A. Brown, T.S. Sihra, 2008 and Syrovatkina et al., 2016)

98

Figure 2: Activation of a GPCR. 1) Ligand binding : Ligand binds to a
receptor in the inactive state at a site within the 7-TM alpha helix bundle resulting
in a conformational change to the receptor complex. 2) GDP/GTP exchange:
GDP will be exchanged with GTP and the alpha subunit will dissociate from the
beta/gamma dimer. 3) Effector Activation: Alpha and Beta will activate multiple
and often overlapping signaling cascades and generate second messengers. 4)
Signal termination: The signal is terminated by following the hydrolysis of
GTP-> GDP by the ATPase domain of the alpha subunit.

99

Level of interaction
Cell type

Type of interaction
Expression of interacting cellspecific substrates

Neuron-type

Expression-signaling efficacy
discrepancy
Extracellular

Coactivation

Intracellular/Subcellular

G protein availability
Trafficking

Compartmentalization

Receptor

Oligomerization

Phenotype/Effect
Cannabinoid Receptor interacting protein 1A
(CRIP1A) inhibits Cb1 mediated signaling. The
presence/absence of Cell specific Adaptor
proteins alters Cb1 localization. Cell-type
specific isozymes of Adenylyl cyclase can be
either inhibited or activated by different Gbg
combinations
(Raehal and Bohn, 2014; Rozenfeld and Devi,
2008; Rhee et al., 1998)
Significant differences in G-protein activation
and receptor regulation in hippocampal /cortical
GABAergic and Glutamatergic neuron (Steindel
et al, 2013)
Brain areas with lower levels of Cb1 expression
have significantly higher G-protein dependent
signaling compared to areas with higher levels of
Cb1 (Breivogel et al, 1997)
Cb1 receptor-mediated signaling is modulated
when coactivated with serotonin or A2A agonists,
Attenuated with µ-opioid agonists, and inhibited
with GABA B and glutamate antagonists (Garcia
et al., 2018)
Sequestering of G proteins limiting availability
for other receptors (Vasquez and Lewis, 1999)
Activated Cb1 can continue signaling during
endocytic formation and lysosomal fusion until
late endosome stage. Lipophillic CB1 agonists
allow Cb1 trafficking to the membrane to become
activated before reaching the membrane
(Rozenfeld and Devi, 2008; Thibault et al., 2013)
Mitochondrial Cb1 receptors (mtCB1) on outer
mitochondrial membrane and can directly impact
Mitochondrial respiration (Fišar Z, et al. 2014)
Cb1 receptor Heterodimerization with D2
(Marcellino D , 2008)
, µ-opioid, Orexin, and A2a receptors results in
the convergence of signaling pathways leading to
attenuation, potentiation or modulation of
Cannabinoid signaling
Several endogenous and exogenous Cb1 agonists
stimulate distinct G protein heterotrimers (Diezalarcia, R, 2016)

Biased agonism

Table 2: Non-exhaustive list of the multiple levels of signaling pleiotropy in the Cb1
receptor

100

Figure 3: Map of the pcDNA3.1 restriction sites and inserts.

101

Figure 4: Map of the pcDNA3.0 containing EGFP and restriction sites

102

Figure 5: Schematic showing the sgRNA sequence and a schematic of the CRISPR/Cas9
system targeting the second coding exon (exon 3) in Gng3.

103

Primer

Sequence 5’à3’

Annealing
Cycles
temperature
(Celsius)
68
30

Size
(bp)
253

AP03
AP04

TGACTTCCTTCAGGGGTAGT
TCCAGAACTGTGAAGGTGCC

WS93
WS94

ACGCAAGATGGTGGAACAG
GGGCATCACAGTAAGTCATCAG

68

30

95

WS99
WS100

TTCGCCGCCATGTCTTC
GTCACAGTAAAGCACAGGATCT

64

35

217

AP07
AP08
AP11
AP12

Target use

Cnr1 for C.
griseus and
golden
hamster
gng3 in C.
griseus and
golden
hamster

Gng10 in
C. griseus
and Golden
hamster
ATCTCTTTCTTGATGTCTCCTGTAT 64
35
183
gng3 in
zebrafish
TAGACTAATCCTGGGCGTCCT
AGAAATGGACTCTTTTGCGTTCA
65
35
314
gng3 in
zebrafish
TGGTGTCTCGTCGAGTGTTG
Table 3: PCR primers. PCR reactions were carried out with an initial denaturing
temperature of 95C for 1 minute, and a subsequent denaturing temperature of 95C for 30
seconds at the start of each cycle. Annealing for 1:30 seconds at indicated temperature.
Extension was carried at 70C for 3 minutes.

104

Figure 6: Embryos lined up on a glass side in a petri dish in preparation of
microinjection

105

Figure 7: PCR products of cDNA isolated from Hamster Brain (Brain) and CHO-K1
(CHO) cells amplified using Crn1 (AP03-AP04), Gng3 (WS93-WS94) and Gng10
(WS99-WS100) specific primers. Visualized on a 1.5% agarose gel stained with
Ethidium Bromide. Panel A; Lane 1: Brain, band at 253bp (Cnr1). Lane 2: CHO, no band
present (Cnr1). Lane 3: Negative control, no band present (Cnr1). Lane 4: Brain, band at
95bp (Gng3). Lane 5: CHO, no band present (Gng3). Lane 6: Negative control. No band
present (Gng3). Lane 7: 100bp ladder. Panel B; Lane 1: Brain, band at 217bp (Gng10).
Lane 2: CHO, band at 217bp (Gng10). Lane 3: Negative control, no band present
(Gng10).

106

Figure 8: Restriction Enzyme Digest of plasmids visualized on an agarose gel verifying
the identity of the plasmid:Lane 1- 1KB DNA ladder , Lane 2- gng3 undigested (band
present ~5660), Lane 3- gng3 (XhoI and HindIII digest) (Band present ~ 5408 and
250bp), Lane 4-Crn1 Undigested (band at 6846), Lane 5- Crn1 (XhoI and EcoR1 digest)
(band at 5427 and 1419), Lane 6- EGFP undigested (band at 6159), Lane 7- EGFP
(Xmn1 digest) bands at 3381 and 2778.

107

Figure 9: Standard curve showing the linear relationship between cAMP concentration
and ∆RLU values (n=3) using the cAMP-Glo assay.

108

Figure 10: FURA-2AM Intracellular calcium tracings in CHO-K1 cells expressing
Cb1+Gng3 (Panel A), Cb1 (Panel B) and CB1+GFP (Panel C) treated with 10µM or
100µM AEA (indicated by dashed line). Tracings indicate no change in the levels of
intracellular calcium upon treatment with 10µM or 100 µM AEA.

109

250

Distance (mm)

200

150

100

50

0
Phase 1 (GFP)

Phase 1 (WT)

Phase 2 (GFP)

Phase 3 (GFP)

Phase 3 (WT)

Figure 11: Average distances travelled during the VMR assay in WT and GFP
injected zebrafish. Phase 1 consisted of 4 minutes of high intensity lighting following 10
minutes of acclimatation. Phase 2 consisted of 4 minutes of low intensity lighting (dark
challenge). Phase 3 consisted of 8 minutes of high intensity lighting. On average, fish in
both groups travelled less in phase 3 than in phase 2, however, there are no significant
differences between treatment groups.

110

14
12
10
8
6
4
2

23.7

22.8

21.9

21

20.1

19.2

18.3

17.4

16.5

15.6

14.7

13.8

12

Control

12.9

11.1

9.3

10.2

8.4

7.5

6.6

5.7

4.8

3.9

3

2.1

1.2

0.3

0

Treatment

Figure 12: Distance travelled before and after sound blast (120dB) in WT zebrafish.
Zebrafish were treated with 10uM of AEA for 15 minutes before recording started. Blast
occurred at 0.33 seconds. The average distance travelled between treatment and control
are insignificant. Dotted line indicated blast of horn.

111

Trial 1
Trial 1 before
Trial 1 after after
Trial 2
Trial 1 before blast
blast
blast
before blast
(treatment) blast (control) (treatment) (control) (treatment)
Average
(mm)
stderr

3.25
0.07

3.15
0.10

54.84
1.15

57.75
1.39

2.60
0.84

Trial 2
before Trial 2 after Trial 2 after
blast
blast
blast
(control) (treatment) (control)
3.55
0.15

Table 4: Average distance travelled in Trials 1 and 2 of Startle Response.

112

35.59
0.08

43.15
1.24

Seconds until turn

Figure 13: Histogram showing the distribution of average startle latency travelled in
Control (Panel A) and Treatment (Panel B) groups.

113

Figure 14: PCR products of gDNA isolated from Crispants. DNA was amplified
using primers specific to gng3 flanking the cut site (AP11-12) and ran on 1.5% agarose
gel stained with ethidium bromide (Lane 1: 2-1, Lane 2: 1-6, Lane 3: 2-5, Lane 4: 2-6,
Lane 5: WT, Lane 6: water blanks, Lane 7: 100bp ladder). Banding is present in lanes 1-5
at ~314bp corresponding to the expected wild-type sequence in lane 5. Heteroduplex
banding (lanes 2 3 and 4) indicates possible Indel formation.

114

Figure 15: Indel plot from samples 2-1 (panel A), 2-5 (panel B), and 2-6 (panel C),
showing the Indel percentage (percentage of the pool with non-wild type sequence; Xaxis) versus indel size (change in base pair between non-wild type and wild type
sequences; y-axis). The R2 value is from a linear regression generated by fitting inferred
editing outcomes with observed editing outcomes and indicates the confidence level of
the ICE score.

115

Figure 16: Photo of sample 2-5 prior to extracting gDNA (panel A) and chromograms of
the edited sample (panel B) and Wild type sample (panel C). The small peaks under the
full sequence traces in panel B represent the non-edited gDNA. The dotted vertical lines
in panels B and C represent the cut-site and the horizontal black line in panel C indicate
the guide sequence.

116

Injection Trial 0: EGFP + Vehicle injected
Uninjected (n=51)

Injected (n=18)

24hpf survival

61%

69%

48hpf survival

100%

100%

72hpf – 7dpf
survival

100%

100%

Table 5: Survival rates for Injection Trial 0. Zebrafish embryos were collected and
microinjected with a solution containing an EGFP + Nuclease-Free Duplex Buffer.
Survival rates for both injected and uninjected embryos was determined.

117

Trial 2- CRISPR Injection
24hpf survival

76%, n=10

48hpf survival

100%

72hpf survival

100%

96hpf survival

0%

Table 6: Survival rates for Injection Trial 1. Zebrafish embryos were collected and
microinjected with the CRISPR solution. Survival rates for both injected and uninjected
embryos was determined.

118

Trial 2- CRISPR Injection
24hpf survival

76%, n=10

48hpf survival

100%

72hpf survival

100%

96hpf survival

0%

Table 7: Survival rates for Injection Trial 2. All Zebrafish embryos were collected and
microinjected with the CRISPR solution.

119

Appendix 1. Animal Research (IACUC) approval information and Reports
Date:

October 12, 2020

To:

Dr. William Schwindinger, Alex Pascule

From: Dr. Candice M. Klingerman, IACUC Chair
Re:

IACUC Approval of Research Protocol

Your protocol for the project referenced below has been approved by the Institutional
Animal Care and Use Committee for the period of time specified in the application.
Please keep in mind that if you plan any significant changes to your animal procedures
during the time period covered by this protocol you must receive IACUC approval before
they are implemented. If you are unsure whether a proposed change is a significant one
that requires IACUC approval, feel free to contact me with questions.
Title of Project:

Pleiotropic Signaling in the Endocannabinoid System: The role of
the γ subunit

Protocol number:

172

Approval Period:

Fall 2020, Spring 2021, Summer 2021

cc.
Dr. R. Lynn Hummel, Interim Dean of College of Science and Technology
Sadie Hauck, Director of Research and Sponsored Programs

120

TO:
FROM:

Bloomsburg University Faculty Performing Research with Animals
Alex Pasculle

DATE: August 18, 2020
RE:

New Research Protocol Form and Guidelines

The Institutional Animal Care and Use Committee (IACUC) recently approved a revision
of the IACUC protocol form. This new protocol must be complete before research with
nonhuman vertebrate animals can be performed at Bloomsburg University.
This form must be submitted and approved prior to nonhuman vertebrate animals use in:
1) classroom demonstration/experimentation
2) experimental research
3) naturalistic observation
Forms can be typed using a word document template on the S:drive, print six (6) copies
and submit to Chairperson. If this protocol has been previously approved fill out Section
A only and submit six (6) copies of the previously approved protocol and acceptance
letter.
If you have any questions, feel free to call me at 4953 or e-mail at cshonis@bloomu.edu.
Bloomsburg University Bloomsburg, Pennsylvania
Animal Research Protocol Form
Section A (must complete):
Protocol # (Chair will assign)
Instructions: This form should be completed and six (6) copies sent to the Chairperson of
the IACUC. The review will be completed within two (2) weeks. Protocols must by
TYPED. Students must have the protocol co-signed by their faculty advisor. Projects
involving experimentation or naturalistic observation require protocols.
Name of Investigator(s): Alex Pasculle, William Schwindinger
Department: Biological and Allied Health Sciences

121

Title of Project: Pleiotropic Signaling in the Endocannabinoid System: The role of
the γ subunit
Semesters in which animals will be used (check all that apply and include year):
Fall ____√____
Year _2020_____
Spring __√_____
Year _2021_____
Summer __√____
Year _2021_____
Species of Animals: Zebrafish (Danio rerio)
Approximate number of animals being used:
65 adult male and female zebrafish and 235 zebrafish embryos.
Has this protocol been previously approved? No
If yes, give protocol # and attach a copy of the approved protocol along with the letter of
approval. If the present protocol is a replication of the previous one then it is not
necessary to complete the rest of this form. Simply sign this form and submit it with a
copy of the previously approved protocol and acceptance letter (six (6) copies of
everything).

Section B (fill out only if new protocol):
What type of hypnotics (i.e. sedatives, analgesics, anesthetics) will be used to eliminate
pain sensation if surgical procedures will be performed? N/A
If no hypnotics will be used to eliminate pain sensation in surgery, give complete
rationale:
No anesthetics will be used to eliminate pain because the early stage zebrafish
embryos (3-7dpf) do not feel pain or distress (Matthews et al. 2012) and will
therefore be unharmed during the CRISPR injections.
What euthanasia method will be used at the end of the experiment?
Euthanasia will be accomplished by rapid chilling in 2-4°C degrees for 10 minutes
(AVMA Guidelines on Euthanasia: 2020 Edition).
Adult zebrafish will be euthanized with tricaine methane sulfonate (TMS).
Euthanasia will be performed by immersing the fish in 200 mg of TMS in 1 liter of
water and sodium bicarbonate to buffer the solution to a pH of 6-7 until they are no
longer moving or breathing. They will then be rapidly decapitated (Harper and
Lawrence, 2011).
Present a brief rationale for involving animals, and the appropriateness of the species and
numbers to be used.
• Cannabinoid receptor signaling in vertebrates and invertebrates are conserved
(Elphick and Egertova 2001)

122

•
•

•
•
•
•

•

•

The CB1 and CB2 receptor have 99% and 88% Amino-acid sequence homology
between humans and zebrafish, respectively (Klee 2012)
In both humans and zebrafish, Cb1 and Cb2 expression is conserved and
localized to the same structures, with high Cb1 expression in the CNS ,
specifically the telencephalon, hypothalamus, tegmentum and anterior hindbrain
and peripheral Cb2 expression (lam et al. 2006)
Expression of the Cb1 receptor transcript in zebrafish begins at 24 hpf (lam et al
2006) allowing for a quick turnaround time to assay after injection
Moreover, gng3 is conserved among humans and zebrafish and share 93.3%
sequence homology (NCBI BLAST)
Heterotrimeric G-proteins function as important mediators in signal transduction
in both humans and zebrafish.
Zebrafish represent a good animal model because their development occurs
externally, and their embryos are transparent. Moreover, high fertility, small size
and relatively sort generational time will allow high-throughput phenotypic
characterization.
It is important to use animals in vivo to study behavior, as in vitro or other
methods are inappropriate. We will use appropriate numbers of living of adult
zebrafish (min n=65, max n=75) in this study to minimize the number of fish
used while achieving adequate numbers for statistical analysis. Zebrafish can
give rise to several hundred embryos each week, which will allow us to limit the
amount of zebrafish being utilized for generating embryos.
The number of embryos to be used in these experiments are similar to those of
Lutchenburg et al. (2019).

To the best of your knowledge, does this project duplicate an activity (e.g. research or
classroom demonstration) that you or others have conducted: __yes______. If yes, give
scientific rationale for duplication.
A project similar to experiment 2 has been already been conducted and approved
by IACUC. In the previous project, line crosses were used to characterize
zebrafish activity after exposure to low and high dose anadamide. The experiment
will be repeated in order to better quantitate zebrafish activity using IDtracker
software. The assays will then be used at a later date when full homozygous gng3
knockouts are obtained.
Experiment 0 Trial using uninjected Wild Type zebrafish embryos to validate a
startle response assay
Summary
Startle response assays have been well-characterized and are routinely used to evaluate
neurological, behavioral and motor function in developing zebrafish (Colwill et al.,
2011). We have chosen experiments that measure startle response early in development
(tactile, visual and auditory)(figure 1). The main purpose of this experiment is to modify
and optimize the startle response assay (using uninjected WT embryos) that will be used
in experiment 1b.
123

Methods
Startle response protocols:
A video camera mounted above a petri dish will record the response evoked when the
embryos are stimulated (Either by an acoustic, tactile or light stimuli). The videos will be
analyzed using open-source software that will quantify locomotive behavior available at
www.opencv.org (information on the software available here): The direction of the
Cbend, the time it takes until the tail touches the head and the time spent active after
dark/light challenges. A Chi-square test will be used to compare responsive vs
nonresponsive zebrafish.
Tactile Startle Response (3dpf)
The assay will be conducted in two phases. Phase 1 will consist of acclimating the
zebrafish larvae to a quiet and light room for 5-10 minutes. Phase 2 will consist of
inducing a tactile stimulus to the larvae and recording the response. The petri dish will be
placed on a vortex prior to assaying. At the start, the vortex will be turned on low for a
brief period of time (about 1 second).
Visual startle response (4dpf) (adapted from MacPhail et al., 2008)
The assay will be conducted in two phases. Phase 1 will consist of acclimating the
zebrafish larvae to a period of darkness in the 96-well plate for 5-10 minutes. Phase 2 will
be a light challenge where lights will be turned on for 10 minutes and recording will
begin. The activity of the larvae will be compared.
Auditory startle response (5dpf) (adapted from Zeddies et al., 2005)
The assay will be conducted in two phases. Phase 1 will consist of acclimating the
zebrafish larvae to a quiet room in a 96-well plate for 5-10 minutes. Phase 2 will begin
after an acoustic stimulus is sounded above the recording apparatus. The activity of the
larvae following each acoustic stimulus and time required for startle response initiation
will be analyzed and compared between groups. Acoustic stimuli will be delivered using
a prerecorded sound played through free-field speakers placed 1-2 feet away from the
experimental set up.
Experiment 1 total animals:
*The same Wild-type zebrafish from experiment 1 will be used to rear embryos.
1. WT embryos (N=10)
Total embryos= 10

!
Figure 1- Time course the startle response assays

124

Experiment 1. In vivo Knock down of gng3 using a sgRNP CRISPR-Cas9
Summary
It has been well established that endocannabinoid signaling mediated by the Cb1 receptor
is pleiotropic (Lutchenburg et al. 2019). While much focus has been on the Gα and Gβ
subunits, the objective of this experiment is to determine the role of the Gγ3 subunit in
activation of the Cb1 receptor. To determine the functional relevance of the Gγ3 subunit
in zebrafish, we will first generate gng3 (Gγ3 subunit) knockout mutants using
CRISPR/Cas9 injected into F0 embryos. This method is preferred over other knockout
approaches in zebrafish have often been complicated by factors like the partial
duplication of the zebrafish genome, and the fact that other methods of genomic
engineering may only be effective early in development (Cornett et al., 2018).
Methods
Fis
h
Ca
re
Fish will be brought into the freshwater fish room (Hartline Science Center; room
B55), group-housed (~30 fish per 10 L aquaria (up to 100 fish in each is appropriate;
Harper and Lawrence, 2011), and allowed to acclimate to the facility for at least 7
days. Afterwards, they will be separated into individual (or small-grouped), 3 L
holding tanks (See Figure 2).
10 L
3L

Figure 2. zebrafish aquaria
Fish will be placed on a 14:10 day/night light cycle to induce spawning. Water
temperature will be maintained at 28°C/82°F with aquarium heaters. An air pump
will deliver oxygen to the water. Water will be filtered through a reverse osmosis/
deionized (RO/DI) filtration system (Spectrapure) and delivered automatically to
each aquaria from a holding tank. Water conditioner (Aqueon) and Instant Ocean
125

Sea Salt (0.5-2.0 g/L) will be added.
Aquaria are specially-made to fit inside of a holding rack (Aquatic Habitats
Benchtop System; Pentair Aquatic Ecosystems). See Figure 3 for a similar set up. A
filter is located below the holding rack. The filter will contain material for biological,
chemical, and mechanical filtration.

Figure 3. zebrafish aquaria setup
Initially, water quality will be checked daily using an API Freshwater Master Test
Kit. After water quality becomes stable, some parameters, like nitrogen, can be tested
weekly. Oxygen will be tested weekly using an oxygen sensor. Water pH will be
maintained between 7-8, alkalinity between 50-150 mg/L CaCO3, hardness at least 75
mg/L CaCO3, salinity between 0.5-2 g/L, dissolved oxygen at 2 mg/L, carbon dioxide
below 20 mg/L, and nitrogenous waste less than 0.02 mg/L (Harper and Lawrence, 2011).
The objective in Experiment 1 is to generate gng3 KO zebrafish to use for behavioral
testing in other experiments.
Microinjection Protocol (Adapted from Rosen et al., 2009, Sorlien et al., 2018) Crosses
will be set up the night prior to F0 embryo collection by placing fish in a divider breeding
tank. The dividers will be lifted, and the fertilized embryos will be collected 1 hour after
dividers have been lifted. The fertilized embryos will be transferred to a 10 cm petri dish
containing water obtained from the same system under the same conditions as the system.
•

Prior to embryo injection, the sgRNA and CRISPR/Cas9 will be kept frozen and
thawed on ice until ready for injection.

•

Two sgRNAs targeting gng3 at different loci will be simultaneously injected into
the F0 embryo and raised until adulthood. Two groups of zebrafish will be
generated, a treatment group (gng3-/-) and a negative control group (water
injected into embryo).

126

•
•

•
•

•

•

Injections will occur between the hours of 10:00 am and 2:00 pm and will be
performed
Microinjection solution consist of a 2:1 ratio of Cas9:sgRNA (Invitrogen). The
final concentration will be 200pg/nL sgRNA and 400 pg/nL Cas9. The total
volume of solution will be 5uL.
The petri dish containing the embryos will be inspected under a dissection
microscope at 2.5X magnification prior to injection
An injection needle will be made by pulling a 1.0mm glass capillary and will be
cut at an angle with a razor to ensure that the opening can pierce the Chorion and
Yolk sac. The injection will be conducted in an agarose container (Chapter 5 in
zebrafish book)
The needle will be place in the micromanipulator and attached to a microinjector
with the air source turned on. 1 nL of the solution will be injected into the yolk
sac of each embryo.
Injected embryos will then be transferred to an incubator for development.

Experiment 1b- Behavioral Analysis of F0 embryos
Summary
Individual G-protein subunits have been shown to have specific roles during
embryogenesis— including angiogenesis, cell migration and motility. Moreover,
Gprotein dependent signaling occurs during development through many different
GPCR’s (Syrovatkina et al., 2017). The next step is to determine the phenotype of Gng3/- zebrafish.
Startle response assays are used to evaluate neurological and motor function in zebrafish
embryos starting as early as 36 hpf and consist of a small stimulus (e.g. light, water-flow,
light) applied to the developing embryo (Colwill et al., 2011) This assay was chosen
because it has been validated in many studies as a useful model to evaluate various
parameters in developing zebrafish that translate well to humans.
Hypothesis
Gng3-/- zebrafish will have an altered startle response when compared to wild type.
Methods
Embryos reared in petri dishes from both treatment and control groups will be collected
and placed in a 96-well plate containing water from the same system. When a small
stimulus is applied to the embryo, the zebrafish will coil up in the opposite direction until
the tail touches the head. This is known as the startle response or C-bend and is a
behavior that promotes the sympathetic fight or flight response (Colwill et al., 2011).
Additionally, other methods of stimulation (i.e. visual, acoustic, tactile) can be performed
at various stages of development to characterize escape and avoidance behaviors. This
will allow us to obtain a better repertoire of phenotypes exhibited by the zebrafish larvae
throughout development. Zebrafish larvae will hatch from their chorion around 2 dpf. We
will start by conducting a tactile startle response assay on zebrafish larvae at 3 dpf. This
assay will consist a tactile stimulus (waterflow or vibrational stimuli). A Visual startle
response assay will be conducted at 4dpf, the developmental period where zebrafish are
127

beginning to develop a visual system. Finally, at 5dpf an auditory startle response will be
measured. Zebrafish will be treated with 10 nM anandamide for 2 hpf prior to assaying.
These assays were chosen because they are simple, high-throughput, easily quantifiable
and will allow for robust screening of larvae early in development. An appropriate
number of embryos will be retained following euthanasia for genotype analysis (see
figure 4). Experiment 0 outlines the trial experiment that we will use to optimize and
validate our experimental design. While we report the protocols for all three assays,
experiment 1b will only use one startle response assay (best characterized in
experiment 0).

.

!

Startle response protocols:
In experiments using Anadamide, embryos will be treated with10nM for 2 hours prior to
assaying (Migliarini et al., 2008). A video camera mounted above a petri dish will record the
response evoked when the embryos are stimulated (Either by an acoustic, tactile or light
stimuli as described above in experiment 0).The videos will be analyzed using opensource software that will quantify locomotive behavior available at www.opencv.org
(information on the software available here): The direction of the Cbend, the time it takes
until the tail touches the head and the time spent active after dark/light challenges. A Chisquare test will be used to compare responsive vs nonresponsive zebrafish.
Experiment 1 total animals:
1. Wild-type female zebrafish (n=10)
2. Wild-type male zebrafish (n=10)
Total Fish= 20 zebrafish
3. Gng3 -/- embryos (n=75)
4. Water control embryos (n=75)
5. Wild type embryos (n=75)
Total embryos= 225

128

Experiment 2
To characterize behavioral related phenotypes associated with Cb1 receptor activation in
adult Zebrafish (Danio rerio).
Summary of Experiment 2
Anandamide is the Fatty acid Neurotransmitter involved in endocannabinoid signaling
and has affinity to both Cb1 and Cb2 in zebrafish and humans (Sulcova et al., 1998).
Both Cb1 and Cb2 are GPCR’s and are therefore dependent upon the heterotrimeric
Gprotein complex. Many studies have previously identified changes in phenotype
associated with the loss of an individual G protein subunit (Schwindinger et al., 2004 and
Leung et al., 2006). In order to gain a complete understanding of the changes in
endocannabinoid signaling associated with an individual G-protein subunit, it is
imperative to develop an assay sensitive enough to discriminate between the differences
in phenotypes. In this current study, adult zebrafish will be administered a low or high
dose of anandamide, and their activity will be measured.
This experiment will be used to validate the assay (using IDtracker) and characterize
behavioral related phenotypes in Wild-type zebrafish. The data obtained from this
experiment will be used later when identifying the phenotypes involved in Gng3 knock
out zebrafish. Moreover, it will allow for a better understanding of how endocannabinoid
signaling effects the behavioral phenotype of zebrafish.
Hypothesis 2
Anandamide will increase fish swimming behavior compared to fish treated with vehicle.

Methods
Fish housing, and the experimental set-up will be the same as in Experiment 1.
After acclimated to the laboratory, fish will be exposed to either 10 uM (low dose) or
100 uM (high dose) of ANA, or vehicle. Anandamide will be purchased as Arachidonoyl
Ethanolamide from Sigma Aldrich (A0580) or Cayman Chemicals (90050). The vehicle
will be a very small dose of ethanol which will be added to the treatment water at a similar
amount as the ANA-treated fish. These doses of ANA have been adapted from Piccinetti
et al., 2010. Fish will be exposed to the ANA or vehicle by placing them into a separate
treatment tank for up to 1 hour. They will then be placed back into their normal aquaria
and physical activity will be recorded using a video camera for an additional hour. Physical
activity data will then be analyzed using the software idTracker, http://www.idtracker.es/.
All fish will be euthanized after testing. At the time of euthanasia, blood may be collected
for additional analysis.
Experiment 2 animals
1. Vehicle control with water (n=15)
2. 10um ANA (low dose) (n=15) 3. 100um ANA (high
dose) (n=15)
Experiment 2:
129

Total number of animals: = 45

130

References
AVMA releases new euthanasia guidelines(2020). . Monmouth Junction: MultiMedia Healthcare Inc.
Retrieved from Agricultural Science Database database. Retrieved from
https://search.proquest.com/docview/ 2377679456
Colwill, R. M., & Creton, R. (2011). Imaging escape and avoidance behavior in zebrafish larvae.
Reviews in the Neurosciences, 22(1), 63-73. doi:10.1515/RNS.2011.008 [doi]
Corley-Smith, G. E., Lim, C. J., & Brandhorst, B. P. (1995). Delayed in vitro fertilization using coho
salmon ovarian fluid in the zebrafish book; A guide for the laboratory use of zebrafish (danio
rerio).
Cornet, C., Di Donato, V., & Terriente, J. (2018). Combining zebrafish and CRISPR/Cas9: Toward a
more efficient drug discovery pipeline. Frontiers in Pharmacology, 9, 703.
doi:10.3389/fphar.2018.00703 [doi] Elphick, M. R., & Egertova, M. (2001). The neurobiology and
evolution of cannabinoid signalling. Philosophical Transactions of the Royal Society of London.Series
B, Biological Sciences, 356(1407), 381-408. doi:10.1098/rstb.2000.0787 [doi]
Harper, C., & Lawrence, C. (2016). The laboratory zebrafish Crc Press.
Klee, E. W., Schneider, H., Clark, K. J., Cousin, M. A., Ebbert, J. O., Hooten, W. M., et al. (2012).
Zebrafish: A model for the study of addiction genetics. Human Genetics, 131(6), 977-1008.
doi:10.1007/ s00439-011-1128-0 [doi]
Lam, C. S., Rastegar, S., & Strahle, U. (2006). Distribution of cannabinoid receptor 1 in the CNS of
zebrafish. Neuroscience, 138(1), 83-95. doi:S0306-4522(05)01198-X [pii]
Leung, T., Chen, H., Stauffer, A. M., Giger, K. E., Sinha, S., Horstick, E. J., et al. (2006). Zebrafish G
protein gamma2 is required for VEGF signaling during angiogenesis. Blood, 108(1), 160-166.
doi:2005-09-3706
[pii]
Luchtenburg, F. J., Schaaf, M. J. M., & Richardson, M. K. (2019). Functional characterization of the
cannabinoid receptors 1 and 2 in zebrafish larvae using behavioral analysis.
Psychopharmacology,
236(7), 2049-2058. doi:10.1007/s00213-019-05193-4 [doi]
MacPhail, R. C., Brooks, J., Hunter, D. L., Padnos, B., Irons, T. D., & Padilla, S. (2009). Locomotion
in larval zebrafish: Influence of time of day, lighting and ethanol. Neurotoxicology, 30(1), 52-58.
doi:10.1016/ j.neuro.2008.09.011 [doi]
Migliarini B, Carnevali O. Anandamide modulates growth and lipid metabolism in the zebrafish Danio
rerio. Mol Cell Endocrinol. 2008 Apr 16;286(1-2 Suppl 1):S12-6. doi:
10.1016/j.mce.2008.01.021. Epub 2008 Feb 3. PMID: 18342434.
Matthews, M., & Varga, Z. M. (2012). Anesthesia and euthanasia in zebrafish. ILAR Journal, 53(2),
192-204.
doi:10.1093/ilar.53.2.192 [doi]
Piccinetti, C. C., Migliarini, B., Petrosino, S., Di Marzo, V., & Carnevali, O. (2010). Anandamide and
AM251, via water, modulate food intake at central and peripheral level in fish. General and
Comparative Endocrinology, 166(2), 259-267. doi:10.1016/j.ygcen.2009.09.017 [doi]
Rosen, J. N., Sweeney, M. F., & Mably, J. D. (2009). Microinjection of zebrafish embryos to analyze
gene function. Journal of Visualized Experiments : JoVE, (25). pii: 1115. doi(25), 10.3791/1115.
doi: 10.3791/1115 [doi]
Salzet, M., & Stefano, G. B. (2002). The endocannabinoid system in invertebrates. Prostaglandins,
Leukotrienes, and Essential Fatty Acids, 66(2-3), 353-361. doi:10.1054/plef.2001.0347 [doi]
Schwindinger, W. F., Borrell, B. M., Waldman, L. C., & Robishaw, J. D. (2009). Mice lacking the G
protein gamma3-subunit show resistance to opioids and diet induced obesity. American Journal
of Physiology.Regulatory, Integrative and Comparative Physiology, 297(5), 1494.
doi:10.1152/ajpregu. 00308.2009 [doi]
Sorlien, E. L., Witucki, M. A., & Ogas, J. (2018). Efficient production and identification of
CRISPR/Cas9generated gene knockouts in the model system danio rerio. Journal of Visualized
Experiments : JoVE, (138). doi(138), 10.3791/56969. doi:10.3791/56969 [doi]
Sulcova, E., Mechoulam, R., & Fride, E. (1998). Biphasic effects of anandamide. Pharmacology,
Biochemistry, and Behavior, 59(2), 347-352. doi:S0091-3057(97)00422-X [pii]

131

Syrovatkina, V., Alegre, K. O., Dey, R., & Huang, X. Y. (2016). Regulation, signaling, and
physiological functions of G-proteins. Journal of Molecular Biology, 428(19), 3850-3868.
doi:10.1016/j.jmb.
2016.08.002 [doi]
Zeddies, D. G., & Fay, R. R. (2005). Development of the acoustically evoked behavioral response in
zebrafish to pure tones. The Journal of Experimental Biology, 208(Pt 7), 1363-1372.
doi:208/7/1363 [pii]

I hereby certify that the information contained herein is true and correct to the best
of my knowledge.

_________________________________________________ ___9/30/20
Investigators(s) Date

_________________________________________________
_________________9/30/20
Faculty Advisor (if applicable) Date

132

Appendix 2. Supplemental Figures

Supplemental Figure 1: Schematic outlining components of the Fura-2AM experiment

133

Supplemental Figure 2: Schematic showing the experimental work-flow of project.

134